ID: 924437479

View in Genome Browser
Species Human (GRCh38)
Location 1:244054965-244054987
Sequence GCTCGCGGAAGTGCGTGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924437479 Original CRISPR GCTCGCGGAAGTGCGTGCTC AGG (reversed) Exonic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
901702938 1:11055066-11055088 GCTCCTGGAAGTTCGTGCTCTGG + Exonic
906231600 1:44169408-44169430 GCTCTGGGAAGTGCATGCTTTGG + Intergenic
916662517 1:166935547-166935569 GCTCCCTGAAGTGCATCCTCAGG - Intronic
919638790 1:200029669-200029691 GCGCCCGGAAGTGCCTGCACAGG - Intronic
924437479 1:244054965-244054987 GCTCGCGGAAGTGCGTGCTCAGG - Exonic
1065968188 10:30785354-30785376 CCGCGCACAAGTGCGTGCTCGGG - Intergenic
1089310206 11:117552932-117552954 GCCCGGGGAAGTGCGTGGTTGGG + Intronic
1094219440 12:27975940-27975962 GCTCGTTGATGTGCGTCCTCGGG + Intergenic
1111818290 13:93182540-93182562 GCTTGCGGAAGTGAGTTGTCAGG + Intergenic
1140203291 16:72912193-72912215 GCGCGGGGAGGTGCCTGCTCAGG + Intronic
1148406966 17:47424039-47424061 GCTCCGGGAGGTGCGCGCTCGGG + Intronic
1153457245 18:5295332-5295354 GCACCCGGGAGTGCGTGCGCTGG + Intronic
1167536850 19:50059159-50059181 GCTCAATGAGGTGCGTGCTCTGG + Intergenic
1168255378 19:55161816-55161838 GCTCGCGGAACTGCGGGGCCAGG + Exonic
1168340781 19:55621891-55621913 GCCCGTGGAAGTGGGTGCGCTGG + Exonic
1168401663 19:56088898-56088920 GCTCGCCGGTGTGCGTGCGCTGG + Exonic
925029948 2:642658-642680 TATCGCGGAAGTGGGGGCTCCGG - Intergenic
927896481 2:26786086-26786108 GCTCGCGGCACAGCGTTCTCTGG + Exonic
928528455 2:32165775-32165797 GTGGGAGGAAGTGCGTGCTCTGG - Intergenic
930071426 2:47369441-47369463 ACTCGCGGGAGGGCGTGCGCCGG - Exonic
931171447 2:59807710-59807732 GCTCCCTGAAGTGTGTGCACAGG + Intergenic
936576267 2:113658204-113658226 GCTCGTGGAACTGGGTGATCTGG + Intergenic
938422276 2:131154915-131154937 GGTCGCGGAAGGGCGTGCGCTGG + Intronic
946587051 2:221201463-221201485 GTTCACGGAAGTTCCTGCTCTGG - Intergenic
947799908 2:232922405-232922427 GCTTGCTGAAGTGGATGCTCTGG - Intronic
1176311840 21:5154720-5154742 CTTCCCGGAAGTGCGTGCTGTGG - Exonic
1177834093 21:26170719-26170741 GCACGCGGAGGAGCGTGCGCGGG - Intronic
1178832764 21:36070277-36070299 GCTGGTGGAAGCGCGGGCTCAGG - Exonic
1179845209 21:44107315-44107337 CTTCCCGGAAGTGCGTGCTGTGG + Exonic
1180187117 21:46145476-46145498 CCTCGCGGAAGGGCGGGATCAGG + Exonic
1185424139 22:50755116-50755138 GCTCGTGGAACTGGGTGATCTGG - Intergenic
954367560 3:50154675-50154697 GGACGCGGAAGGGGGTGCTCAGG + Intergenic
958641782 3:96814547-96814569 GCGCGCGCAAGAGCGAGCTCGGG - Intergenic
990537089 5:56733502-56733524 GCACCCGGAAGTCCCTGCTCTGG + Intergenic
992796118 5:80256183-80256205 GCCAGCGGAAGTGCGAGCCCGGG - Intergenic
1006230668 6:32583919-32583941 GCTCTCAGAACTGCTTGCTCCGG + Intronic
1018669706 6:166168193-166168215 CCTCGCGGAAGTGCGGGCTGGGG - Intronic
1019629089 7:2036982-2037004 GCACGCGGAAGCTCGTGCTGTGG - Intronic
1020275599 7:6622752-6622774 GCTCGCCCGAGTGCGTGCGCCGG - Exonic
1020281599 7:6652937-6652959 GCTCGCCGGTGTGCGTGCGCTGG - Exonic
1049682722 8:143926852-143926874 GCTCGCTGTAGTGCGTACGCAGG + Exonic
1050091159 9:2017028-2017050 GGGCGCGGCAGTGCGGGCTCCGG + Intronic
1055308379 9:74952974-74952996 GCGACCGGAAGTGCGCGCTCGGG + Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1061932446 9:133840210-133840232 GCACGAGGAAATGCATGCTCAGG - Intronic