ID: 924439469

View in Genome Browser
Species Human (GRCh38)
Location 1:244074267-244074289
Sequence CTGGGTGGCTGGCGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924439453_924439469 27 Left 924439453 1:244074217-244074239 CCAGTCAAACTTAGAAAAAACAA No data
Right 924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG No data
924439452_924439469 28 Left 924439452 1:244074216-244074238 CCCAGTCAAACTTAGAAAAAACA No data
Right 924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924439469 Original CRISPR CTGGGTGGCTGGCGGCAGGG TGG Intergenic
No off target data available for this crispr