ID: 924447232

View in Genome Browser
Species Human (GRCh38)
Location 1:244144639-244144661
Sequence GTATAAGTATTAGCACGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924447232_924447234 10 Left 924447232 1:244144639-244144661 CCTTTACGTGCTAATACTTATAC No data
Right 924447234 1:244144672-244144694 TAGAGAAATTGTAGGTAATATGG No data
924447232_924447233 2 Left 924447232 1:244144639-244144661 CCTTTACGTGCTAATACTTATAC No data
Right 924447233 1:244144664-244144686 TCAACATTTAGAGAAATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924447232 Original CRISPR GTATAAGTATTAGCACGTAA AGG (reversed) Intergenic
No off target data available for this crispr