ID: 924449538

View in Genome Browser
Species Human (GRCh38)
Location 1:244165150-244165172
Sequence CTTAATCAACAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924449534_924449538 8 Left 924449534 1:244165119-244165141 CCTGGGGACTGGGATGGAAGACA No data
Right 924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG No data
924449527_924449538 27 Left 924449527 1:244165100-244165122 CCTTATATAAGACAGGGAACCTG No data
Right 924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG No data
924449526_924449538 28 Left 924449526 1:244165099-244165121 CCCTTATATAAGACAGGGAACCT No data
Right 924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924449538 Original CRISPR CTTAATCAACAGAGTGAGGA AGG Intergenic
No off target data available for this crispr