ID: 924458147

View in Genome Browser
Species Human (GRCh38)
Location 1:244234522-244234544
Sequence GTGACCCACCCAGGATCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458147_924458152 18 Left 924458147 1:244234522-244234544 CCACCTGATCCTGGGTGGGTCAC No data
Right 924458152 1:244234563-244234585 AGCGTCCTCAGCTGTCGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458147 Original CRISPR GTGACCCACCCAGGATCAGG TGG (reversed) Intergenic
No off target data available for this crispr