ID: 924458669

View in Genome Browser
Species Human (GRCh38)
Location 1:244238792-244238814
Sequence CCTAGTTGGCCCAAGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458669_924458676 26 Left 924458669 1:244238792-244238814 CCACTCAACTTGGGCCAACTAGG No data
Right 924458676 1:244238841-244238863 AAAGTATATTTAGCTGGGCATGG No data
924458669_924458675 21 Left 924458669 1:244238792-244238814 CCACTCAACTTGGGCCAACTAGG No data
Right 924458675 1:244238836-244238858 TGAAGAAAGTATATTTAGCTGGG No data
924458669_924458674 20 Left 924458669 1:244238792-244238814 CCACTCAACTTGGGCCAACTAGG No data
Right 924458674 1:244238835-244238857 GTGAAGAAAGTATATTTAGCTGG No data
924458669_924458677 29 Left 924458669 1:244238792-244238814 CCACTCAACTTGGGCCAACTAGG No data
Right 924458677 1:244238844-244238866 GTATATTTAGCTGGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458669 Original CRISPR CCTAGTTGGCCCAAGTTGAG TGG (reversed) Intergenic
No off target data available for this crispr