ID: 924458671

View in Genome Browser
Species Human (GRCh38)
Location 1:244238806-244238828
Sequence AAGAAGGTCTTACTCCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458671_924458676 12 Left 924458671 1:244238806-244238828 CCAACTAGGAGTAAGACCTTCTT No data
Right 924458676 1:244238841-244238863 AAAGTATATTTAGCTGGGCATGG No data
924458671_924458677 15 Left 924458671 1:244238806-244238828 CCAACTAGGAGTAAGACCTTCTT No data
Right 924458677 1:244238844-244238866 GTATATTTAGCTGGGCATGGTGG No data
924458671_924458674 6 Left 924458671 1:244238806-244238828 CCAACTAGGAGTAAGACCTTCTT No data
Right 924458674 1:244238835-244238857 GTGAAGAAAGTATATTTAGCTGG No data
924458671_924458675 7 Left 924458671 1:244238806-244238828 CCAACTAGGAGTAAGACCTTCTT No data
Right 924458675 1:244238836-244238858 TGAAGAAAGTATATTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458671 Original CRISPR AAGAAGGTCTTACTCCTAGT TGG (reversed) Intergenic
No off target data available for this crispr