ID: 924458672

View in Genome Browser
Species Human (GRCh38)
Location 1:244238822-244238844
Sequence CTTTCTTCACTAATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458672_924458676 -4 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458676 1:244238841-244238863 AAAGTATATTTAGCTGGGCATGG No data
924458672_924458681 30 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458681 1:244238875-244238897 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
924458672_924458678 26 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458678 1:244238871-244238893 CGCCTATAATCCCAGCACTTTGG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
924458672_924458674 -10 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458674 1:244238835-244238857 GTGAAGAAAGTATATTTAGCTGG No data
924458672_924458675 -9 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458675 1:244238836-244238858 TGAAGAAAGTATATTTAGCTGGG No data
924458672_924458679 27 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458679 1:244238872-244238894 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
924458672_924458677 -1 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458677 1:244238844-244238866 GTATATTTAGCTGGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458672 Original CRISPR CTTTCTTCACTAATGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr