ID: 924458675

View in Genome Browser
Species Human (GRCh38)
Location 1:244238836-244238858
Sequence TGAAGAAAGTATATTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458669_924458675 21 Left 924458669 1:244238792-244238814 CCACTCAACTTGGGCCAACTAGG No data
Right 924458675 1:244238836-244238858 TGAAGAAAGTATATTTAGCTGGG No data
924458671_924458675 7 Left 924458671 1:244238806-244238828 CCAACTAGGAGTAAGACCTTCTT No data
Right 924458675 1:244238836-244238858 TGAAGAAAGTATATTTAGCTGGG No data
924458672_924458675 -9 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458675 1:244238836-244238858 TGAAGAAAGTATATTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458675 Original CRISPR TGAAGAAAGTATATTTAGCT GGG Intergenic
No off target data available for this crispr