ID: 924458678

View in Genome Browser
Species Human (GRCh38)
Location 1:244238871-244238893
Sequence CGCCTATAATCCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 807629
Summary {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458673_924458678 19 Left 924458673 1:244238829-244238851 CCATTAGTGAAGAAAGTATATTT No data
Right 924458678 1:244238871-244238893 CGCCTATAATCCCAGCACTTTGG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
924458672_924458678 26 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458678 1:244238871-244238893 CGCCTATAATCCCAGCACTTTGG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458678 Original CRISPR CGCCTATAATCCCAGCACTT TGG Intergenic
Too many off-targets to display for this crispr