ID: 924458678 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:244238871-244238893 |
Sequence | CGCCTATAATCCCAGCACTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 807629 | |||
Summary | {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
924458673_924458678 | 19 | Left | 924458673 | 1:244238829-244238851 | CCATTAGTGAAGAAAGTATATTT | No data | ||
Right | 924458678 | 1:244238871-244238893 | CGCCTATAATCCCAGCACTTTGG | 0: 9370 1: 149078 2: 285159 3: 214832 4: 149190 |
||||
924458672_924458678 | 26 | Left | 924458672 | 1:244238822-244238844 | CCTTCTTCCATTAGTGAAGAAAG | No data | ||
Right | 924458678 | 1:244238871-244238893 | CGCCTATAATCCCAGCACTTTGG | 0: 9370 1: 149078 2: 285159 3: 214832 4: 149190 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
924458678 | Original CRISPR | CGCCTATAATCCCAGCACTT TGG | Intergenic | ||
Too many off-targets to display for this crispr |