ID: 924458679

View in Genome Browser
Species Human (GRCh38)
Location 1:244238872-244238894
Sequence GCCTATAATCCCAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 855615
Summary {0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458672_924458679 27 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458679 1:244238872-244238894 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
924458673_924458679 20 Left 924458673 1:244238829-244238851 CCATTAGTGAAGAAAGTATATTT No data
Right 924458679 1:244238872-244238894 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458679 Original CRISPR GCCTATAATCCCAGCACTTT GGG Intergenic
Too many off-targets to display for this crispr