ID: 924458681

View in Genome Browser
Species Human (GRCh38)
Location 1:244238875-244238897
Sequence TATAATCCCAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 880486
Summary {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924458672_924458681 30 Left 924458672 1:244238822-244238844 CCTTCTTCCATTAGTGAAGAAAG No data
Right 924458681 1:244238875-244238897 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
924458673_924458681 23 Left 924458673 1:244238829-244238851 CCATTAGTGAAGAAAGTATATTT No data
Right 924458681 1:244238875-244238897 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924458681 Original CRISPR TATAATCCCAGCACTTTGGG AGG Intergenic
Too many off-targets to display for this crispr