ID: 924463892

View in Genome Browser
Species Human (GRCh38)
Location 1:244283456-244283478
Sequence GACGATGCCCCCAGTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924463885_924463892 -1 Left 924463885 1:244283434-244283456 CCGGCTTGCCCCCACAGCTCCTG No data
Right 924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG No data
924463880_924463892 27 Left 924463880 1:244283406-244283428 CCAATGCAGCTCTCACCATTTCT No data
Right 924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG No data
924463883_924463892 3 Left 924463883 1:244283430-244283452 CCACCCGGCTTGCCCCCACAGCT No data
Right 924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG No data
924463886_924463892 -9 Left 924463886 1:244283442-244283464 CCCCCACAGCTCCTGACGATGCC No data
Right 924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG No data
924463887_924463892 -10 Left 924463887 1:244283443-244283465 CCCCACAGCTCCTGACGATGCCC No data
Right 924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG No data
924463884_924463892 0 Left 924463884 1:244283433-244283455 CCCGGCTTGCCCCCACAGCTCCT No data
Right 924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG No data
924463882_924463892 12 Left 924463882 1:244283421-244283443 CCATTTCTGCCACCCGGCTTGCC No data
Right 924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924463892 Original CRISPR GACGATGCCCCCAGTGTTGT GGG Intergenic
No off target data available for this crispr