ID: 924464321

View in Genome Browser
Species Human (GRCh38)
Location 1:244286258-244286280
Sequence CAGTGTTTTCAGAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924464321_924464329 13 Left 924464321 1:244286258-244286280 CCTGCCACCCTCTGAAAACACTG No data
Right 924464329 1:244286294-244286316 TTCAGATGATGAGAAACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924464321 Original CRISPR CAGTGTTTTCAGAGGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr