ID: 924464842

View in Genome Browser
Species Human (GRCh38)
Location 1:244290617-244290639
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924464836_924464842 -10 Left 924464836 1:244290604-244290626 CCCCTCATTTCGACAGTGGGTAG No data
Right 924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr