ID: 924466830

View in Genome Browser
Species Human (GRCh38)
Location 1:244305781-244305803
Sequence TAGGGTAACCTGAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924466830_924466842 12 Left 924466830 1:244305781-244305803 CCAGCCCCCTTCAGGTTACCCTA No data
Right 924466842 1:244305816-244305838 CAGGTAACTGTCATTGGTGTGGG No data
924466830_924466844 27 Left 924466830 1:244305781-244305803 CCAGCCCCCTTCAGGTTACCCTA No data
Right 924466844 1:244305831-244305853 GGTGTGGGAAGCCAGGCCACTGG 0: 5
1: 6
2: 12
3: 49
4: 317
924466830_924466843 20 Left 924466830 1:244305781-244305803 CCAGCCCCCTTCAGGTTACCCTA No data
Right 924466843 1:244305824-244305846 TGTCATTGGTGTGGGAAGCCAGG No data
924466830_924466841 11 Left 924466830 1:244305781-244305803 CCAGCCCCCTTCAGGTTACCCTA No data
Right 924466841 1:244305815-244305837 TCAGGTAACTGTCATTGGTGTGG No data
924466830_924466836 -7 Left 924466830 1:244305781-244305803 CCAGCCCCCTTCAGGTTACCCTA No data
Right 924466836 1:244305797-244305819 TACCCTAAGGACAGTCCTTCAGG No data
924466830_924466839 6 Left 924466830 1:244305781-244305803 CCAGCCCCCTTCAGGTTACCCTA No data
Right 924466839 1:244305810-244305832 GTCCTTCAGGTAACTGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924466830 Original CRISPR TAGGGTAACCTGAAGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr