ID: 924477489

View in Genome Browser
Species Human (GRCh38)
Location 1:244394833-244394855
Sequence ATCTTCCTCTTGAAGACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924477483_924477489 8 Left 924477483 1:244394802-244394824 CCCCCATCACAGCACAGCGATGC No data
Right 924477489 1:244394833-244394855 ATCTTCCTCTTGAAGACCTCTGG No data
924477485_924477489 6 Left 924477485 1:244394804-244394826 CCCATCACAGCACAGCGATGCCA No data
Right 924477489 1:244394833-244394855 ATCTTCCTCTTGAAGACCTCTGG No data
924477484_924477489 7 Left 924477484 1:244394803-244394825 CCCCATCACAGCACAGCGATGCC No data
Right 924477489 1:244394833-244394855 ATCTTCCTCTTGAAGACCTCTGG No data
924477486_924477489 5 Left 924477486 1:244394805-244394827 CCATCACAGCACAGCGATGCCAG No data
Right 924477489 1:244394833-244394855 ATCTTCCTCTTGAAGACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924477489 Original CRISPR ATCTTCCTCTTGAAGACCTC TGG Intergenic
No off target data available for this crispr