ID: 924485760

View in Genome Browser
Species Human (GRCh38)
Location 1:244481959-244481981
Sequence CACATTAAGACCTAAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924485759_924485760 -8 Left 924485759 1:244481944-244481966 CCAATTTCATTTACACACATTAA 0: 1
1: 0
2: 5
3: 31
4: 434
Right 924485760 1:244481959-244481981 CACATTAAGACCTAAGAGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 95
924485758_924485760 14 Left 924485758 1:244481922-244481944 CCAAGAAGCACTGAATGGGTTAC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 924485760 1:244481959-244481981 CACATTAAGACCTAAGAGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924485760 Original CRISPR CACATTAAGACCTAAGAGCT AGG Intronic
900275822 1:1826864-1826886 TACATTAACAGCTAAGATCTTGG - Intronic
907811375 1:57874001-57874023 CAGATGAAGACCAGAGAGCTTGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912674864 1:111669523-111669545 AGCAATAAGACATAAGAGCTTGG + Intronic
915440767 1:155944259-155944281 CACATAAAGAACTCAGAGGTTGG + Intergenic
916339773 1:163718971-163718993 CACATTAAGAACTAAGAAAAAGG - Intergenic
916515881 1:165516283-165516305 GAAATGAAGACCTAAGAGCTGGG + Intergenic
921317633 1:213906926-213906948 AATATTAAGGCCTCAGAGCTGGG - Intergenic
924485760 1:244481959-244481981 CACATTAAGACCTAAGAGCTAGG + Intronic
1066229433 10:33418037-33418059 CACGATAATACCTAAGAGGTGGG + Intergenic
1067835195 10:49634071-49634093 CACATTCAGTCTTGAGAGCTCGG - Intronic
1069705620 10:70457522-70457544 CACATAAATACCTAAGTGCAGGG - Intergenic
1073276812 10:102318924-102318946 CTTATTAAGACCTTATAGCTGGG + Intronic
1075090566 10:119442001-119442023 CACATTAGGATCTCAGACCTGGG + Exonic
1078818879 11:14855720-14855742 AAGATTATGACTTAAGAGCTAGG + Intronic
1078856554 11:15210024-15210046 CTCTTTGAGACCTAAGAACTTGG - Intronic
1079820906 11:25126997-25127019 CACAATTAGAACTAAGAGCATGG + Intergenic
1084092054 11:66885174-66885196 CACATTCTGACCTAGGTGCTAGG - Intronic
1085829152 11:79881163-79881185 CACAATAATACCTATGAGGTAGG + Intergenic
1093942693 12:25071901-25071923 CCCATTAAGAAATAGGAGCTGGG + Intronic
1094726649 12:33125636-33125658 CACATTAAGTCCTAAAAGATAGG + Intergenic
1098434941 12:70458703-70458725 CCCTTCAAGACCTAAGAGTTAGG + Intergenic
1100538863 12:95538796-95538818 CACACAAAGATCTAAGAGCTTGG + Intronic
1100799554 12:98216814-98216836 AACATAAACACCTAAGAGCAGGG + Intergenic
1105425125 13:20287312-20287334 CACACTAAGATCCAATAGCTTGG - Intergenic
1106069857 13:26399308-26399330 CACATTAAGACTTAAAAGAGAGG - Intronic
1109099097 13:58156958-58156980 CACATTCAGAATTAAGAGTTGGG + Intergenic
1110859061 13:80327923-80327945 CACATGTAGTCCTAATAGCTAGG + Intergenic
1111600448 13:90467504-90467526 CACATTAAGAACTGAGAGAAAGG - Intergenic
1115959276 14:38816762-38816784 CAAATTAAGACATGAAAGCTGGG - Intergenic
1116150571 14:41136351-41136373 CACCTGATTACCTAAGAGCTCGG - Intergenic
1118552257 14:66966722-66966744 AATATTAAGACCTAAAAGTTGGG + Intronic
1118737204 14:68710576-68710598 CCCATTGAGTCCTAAGACCTTGG + Intronic
1120398589 14:84000133-84000155 CAAATGGTGACCTAAGAGCTAGG + Intergenic
1121746604 14:96300063-96300085 TTCATTAAGACATAAAAGCTAGG - Intronic
1125729760 15:41886534-41886556 CACACTCAGACCCAGGAGCTTGG + Intronic
1131417472 15:92273222-92273244 CACATAAAGAGCCAAGAGATGGG + Intergenic
1133322568 16:4923385-4923407 CATACAAAGACCTAAGAGTTGGG + Intronic
1138611033 16:58124182-58124204 CACATTAAGGGCTTAGGGCTGGG + Intronic
1138706780 16:58923257-58923279 CACATTAAGACTGAAAAGCAGGG - Intergenic
1140162469 16:72512344-72512366 CACCTCATCACCTAAGAGCTCGG - Intergenic
1140841868 16:78847178-78847200 CATATTTAGAACTAAGATCTAGG + Intronic
1153912132 18:9713675-9713697 CAAATTAAGACATAAGGGATGGG - Intronic
1156897564 18:42263810-42263832 AATGTTAAGACCTTAGAGCTAGG + Intergenic
1159873646 18:73786702-73786724 AACAGAAAGACCTCAGAGCTAGG - Intergenic
1165547336 19:36551756-36551778 CAAATTAAGACCACAGAGATTGG + Intronic
1167795579 19:51705994-51706016 CACTTTAAAACCTAAGTCCTTGG - Intergenic
925738489 2:6984774-6984796 CACATTAAATCCTAAAGGCTGGG - Intronic
926046655 2:9715008-9715030 CACATCAAGTGCTGAGAGCTTGG - Intergenic
932988018 2:76750325-76750347 ATCATTAAGACTTAAAAGCTTGG - Intronic
942283774 2:174393201-174393223 CACAAGAAGACTAAAGAGCTTGG + Intronic
945209872 2:207371321-207371343 AACATTAAGAACAAAGAGCAGGG - Intergenic
946602971 2:221371922-221371944 CAGATTTAGACCTAAGAGTAAGG - Intergenic
948782745 2:240333228-240333250 CACAGGAAGACCTCAGAGCATGG + Intergenic
1168741492 20:195230-195252 CACAATAAGAACTAAGAAGTTGG + Intergenic
1182041278 22:27240601-27240623 CACAACAAGACCAAGGAGCTGGG + Intergenic
1182266795 22:29122642-29122664 CATATTAAGACCTACTGGCTGGG + Intronic
1183190319 22:36318288-36318310 CACATTGATACCCAAGAGATGGG + Exonic
959426844 3:106200621-106200643 CAAATTAAGAAGTAAGATCTGGG - Intergenic
966865502 3:184256970-184256992 AAACTTAAGAACTAAGAGCTAGG - Intronic
966996694 3:185288615-185288637 TGCATTAAGGCCTTAGAGCTGGG + Intronic
967950784 3:194838657-194838679 CACATGAATCCCTCAGAGCTAGG - Intergenic
968713563 4:2138274-2138296 CACCCAAAGCCCTAAGAGCTAGG + Intronic
971169046 4:24214502-24214524 GACATAAAAACCTAAGAGATGGG + Intergenic
971641809 4:29143743-29143765 CACAGTAAGACTGAAGAGCAGGG - Intergenic
971998420 4:33996528-33996550 CACAGGATGACATAAGAGCTTGG + Intergenic
972974987 4:44623316-44623338 AAAAATAAGACATAAGAGCTGGG + Intronic
974436597 4:61864530-61864552 CACAATAACATCTAAAAGCTTGG - Intronic
975968916 4:80010245-80010267 CACATTAAGCTCTAAAATCTAGG + Intronic
976785956 4:88821270-88821292 CAAATTAAACTCTAAGAGCTGGG + Intronic
977612221 4:99047753-99047775 CACACTAAGACCCAGGAGCTGGG - Intronic
980134174 4:128844612-128844634 TACTTTAAAACCTAAGAGATGGG - Intronic
988414775 5:30932270-30932292 CACATAAAGAACAAAGAGTTTGG - Intergenic
989445426 5:41522864-41522886 CACATTAAAACATAACACCTTGG - Intergenic
996188932 5:120514584-120514606 GAACTTAAGACTTAAGAGCTAGG - Intronic
999680895 5:154059041-154059063 CACCTCAAGGCCAAAGAGCTGGG + Intronic
1004532454 6:16465851-16465873 CACATAAAGACATGAGAGATGGG + Intronic
1005597470 6:27393260-27393282 CAGATTGATACCTCAGAGCTTGG + Intronic
1006079783 6:31558522-31558544 CAGATTGAGACCTGGGAGCTGGG + Exonic
1007466539 6:42055940-42055962 CACATTGAAACCTAAGAGACAGG - Exonic
1008540641 6:52544040-52544062 CACATTTTGACTGAAGAGCTAGG + Intronic
1011167898 6:84470645-84470667 CTGGTTAAGACCTAAGAGCTAGG + Intergenic
1013242173 6:108256508-108256530 CCCATTTAGTCCTAAGAGGTAGG + Intronic
1014827458 6:126062535-126062557 CACCTGAAGACCTAAGTCCTAGG - Intergenic
1015066580 6:129036833-129036855 CACAACAATGCCTAAGAGCTGGG - Intronic
1015539448 6:134299092-134299114 TAAATTAAGAGCTGAGAGCTGGG - Intronic
1021534628 7:21689449-21689471 CACATGAAGATTTAAGAGATGGG + Intronic
1023951880 7:44852679-44852701 CAAATTAAGGCAAAAGAGCTAGG - Intergenic
1029115563 7:98235222-98235244 CAGTTTAAGAACTAACAGCTGGG + Intronic
1034887869 7:154812183-154812205 CACATTAGGACATAAGGGCTGGG + Intronic
1036512681 8:9415086-9415108 CACATAAAGACCCAAAGGCTTGG + Intergenic
1038667005 8:29546658-29546680 CACACAAAGAGCTAATAGCTGGG + Intergenic
1042512264 8:69624401-69624423 CACATTAAGACTGATCAGCTAGG + Intronic
1046777511 8:118179694-118179716 CAGAATATGACCTAAGTGCTTGG - Intergenic
1047075373 8:121395704-121395726 CACATGAAGTTTTAAGAGCTAGG + Intergenic
1056282279 9:85053139-85053161 CACAGTAACTCATAAGAGCTGGG - Intergenic
1056721962 9:89080304-89080326 CAAATCAAGACCTCAGAACTCGG + Intronic
1059397746 9:114049025-114049047 CACATCAAGAGCTATGTGCTTGG + Exonic
1060956119 9:127641441-127641463 CAAATTGAGACCTGAGACCTGGG + Intronic
1188687504 X:33086687-33086709 CACTTTAAAATCTAACAGCTTGG - Intronic
1189283838 X:39838175-39838197 CACAGAAAGCCCCAAGAGCTGGG - Intergenic
1193369230 X:80673658-80673680 CACACTAAGATCTTAAAGCTGGG + Exonic