ID: 924490926

View in Genome Browser
Species Human (GRCh38)
Location 1:244536562-244536584
Sequence AGACAGAGTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 2, 1: 5, 2: 37, 3: 88, 4: 373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924490926_924490932 30 Left 924490926 1:244536562-244536584 CCCACAATCACTGCACTCTGTCT 0: 2
1: 5
2: 37
3: 88
4: 373
Right 924490932 1:244536615-244536637 TATGCAGCCACTACCGAGATGGG 0: 1
1: 0
2: 0
3: 1
4: 42
924490926_924490931 29 Left 924490926 1:244536562-244536584 CCCACAATCACTGCACTCTGTCT 0: 2
1: 5
2: 37
3: 88
4: 373
Right 924490931 1:244536614-244536636 CTATGCAGCCACTACCGAGATGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924490926 Original CRISPR AGACAGAGTGCAGTGATTGT GGG (reversed) Intronic
900783410 1:4632369-4632391 AGTCATAGTGCAGGCATTGTAGG - Intergenic
901531673 1:9857529-9857551 AGACAAAGTGCAGAGATTACAGG - Intronic
902280078 1:15367892-15367914 AGACAGAGTGCAGGGGCTGAGGG - Intronic
903614075 1:24639342-24639364 AGACAGAGTGAGGGGATTGAGGG + Intronic
903815835 1:26063724-26063746 AGACAGATTGCAGTAGTTCTGGG - Intronic
904229280 1:29054164-29054186 CAACACAGTGCAGTGACTGTGGG - Intronic
904245678 1:29186176-29186198 AGACTGAATGCAGTGGTTGAAGG - Intergenic
905120882 1:35681008-35681030 AGACAGATTGCAGTGATTTGGGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906108163 1:43307001-43307023 AGGCAGAGGGCAGAGGTTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907793455 1:57691170-57691192 AGACACAGAGCACTGATTGGTGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
911854046 1:102854379-102854401 AGACACAGAGCACTGATTGGTGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912258019 1:108080893-108080915 AGACAGAGTGAAGTGAGTTGAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915011210 1:152687797-152687819 AGAAGGAGTTCAGTGACTGTGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916105604 1:161428440-161428462 AGAAAGGGTGTAGTGAGTGTTGG + Intergenic
917186333 1:172360833-172360855 AAACAGAGTGCAGTAAGTTTAGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918247107 1:182670040-182670062 AGAAAGAGAGCAGTAATTTTTGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
921333030 1:214058793-214058815 AGACAGGATGGAGTGATTGGGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
921959651 1:221021524-221021546 AGACAGAGGGGAATGATGGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1063205583 10:3827404-3827426 GGACACAGGGCAGTGATTGGTGG + Intergenic
1064962493 10:20981046-20981068 TCACAAAGTGCAGTGATTATAGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065370597 10:24981069-24981091 GGACAGAATGCACTGATTATGGG + Intergenic
1065644063 10:27816180-27816202 AGACAGGGTGCAGGGACAGTGGG - Intronic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1065997363 10:31071344-31071366 AGCCAGAGTTCAGTGAATGCAGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1068216791 10:53991528-53991550 AGACACAGAGCACTGATTGGTGG - Intronic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070084335 10:73221087-73221109 AGACAGAGTTTAGTGGTTGCTGG + Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072999229 10:100274004-100274026 TGCCAGAGTGCTGAGATTGTAGG - Intronic
1074127367 10:110539687-110539709 ACACAGAGTGCTCTGATTGGTGG - Intergenic
1074164605 10:110864010-110864032 AGACAGAGTCCAGTGATGGTGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075933926 10:126323579-126323601 GCACAGAGTGGAGTGATTGCAGG - Intronic
1075978742 10:126719360-126719382 ACACAGAGTGTAGTGGTGGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1078027170 11:7707793-7707815 AGACAGAATGTAGTGAATTTGGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079443280 11:20536259-20536281 AGCCAGAGTGCCGTGACTGTGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079726352 11:23884933-23884955 AGACAGATTTCAGTGAATTTAGG + Intergenic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081930927 11:46870678-46870700 AGCCAGAGTGCTGTGATTACAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1084771705 11:71347147-71347169 TGACTGAGTGCAGTGAGTGAAGG + Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085929447 11:81063739-81063761 AGCCAGGGTGGAGTTATTGTAGG - Intergenic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1087126938 11:94637673-94637695 AGACAGAGGGCAGCGATCCTGGG + Intergenic
1087874549 11:103339967-103339989 AGCAAGAGTGAAGTGAGTGTGGG - Intronic
1088474872 11:110225054-110225076 AGCCAGTGTGCATTGACTGTAGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089503584 11:118947904-118947926 AGACAGACTGCAGTGATTTTAGG - Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090961500 11:131561479-131561501 AGACAGAGTGAAAGGATAGTGGG + Intronic
1091775089 12:3179272-3179294 AGTCAGAGTGGGGTGAGTGTCGG - Intronic
1092184676 12:6470282-6470304 GGAGAGGGTGCAATGATTGTGGG + Intronic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1093259615 12:16918690-16918712 AGACAGACAGCAGTTATTGTGGG - Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096668362 12:53181771-53181793 AGGCAGAGTCCAGGGATTCTTGG + Exonic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098915703 12:76254844-76254866 AGACAGAGTTGAGAGACTGTGGG + Intergenic
1099042889 12:77677703-77677725 AGCAAGCGTGCAGTGAATGTTGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099523213 12:83689423-83689445 AAAGACAGTGCGGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101474350 12:105029943-105029965 AGAAAGAGTGCTGTTATTATAGG - Intronic
1102151499 12:110691523-110691545 AGACAGAGTGGAGAGGATGTGGG + Intronic
1102803578 12:115759264-115759286 AGACAGAAGGCAGTGAATATCGG - Intergenic
1104188294 12:126453636-126453658 TCACAGTGTGCGGTGATTGTTGG + Intergenic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1105551832 13:21404488-21404510 AGACAGAGTGCTGGGATTACAGG - Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1114392299 14:22322923-22322945 AGAAAGAGTGCTGAGATTGGAGG + Intergenic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1115587715 14:34831442-34831464 AGACAGTGTGCAGTGAAAGGTGG + Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117545840 14:56794513-56794535 GGTCAGAGTGTGGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1119753000 14:77093779-77093801 AGGCAGAGGCCAGTGATAGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121836512 14:97097272-97097294 AGAAAGAGTGCAATGAGTATCGG - Intergenic
1122477481 14:102020958-102020980 AGGCAGAGTGCAGAGTATGTTGG + Intronic
1122916436 14:104861174-104861196 AGACAGAGGGTAGTGATGGATGG - Intergenic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1125077413 15:35635396-35635418 AGACAGAGGGCAGTTAGAGTAGG + Intergenic
1125271505 15:37943737-37943759 GGAAAGAGTACTGTGATTGTAGG - Intronic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127619756 15:60722377-60722399 AGAAATAGTGCAGTGAGTGATGG - Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128267473 15:66279373-66279395 AGACAGATTGCAATGAGTGGAGG - Intergenic
1129064164 15:72887241-72887263 AGACAGTGTGGAGTGAATCTAGG + Intergenic
1130395879 15:83500821-83500843 AGAAAGAGTCCAAGGATTGTGGG - Intronic
1131122618 15:89831979-89832001 TGACAGAGTGCTCAGATTGTTGG - Exonic
1131134246 15:89921220-89921242 ACACAGAGTCCATTGATTGAAGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132770777 16:1561793-1561815 AGACAGACCGCAGTGTTTGCTGG + Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134537354 16:15036754-15036776 TGAAGGAGAGCAGTGATTGTGGG + Exonic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140711851 16:77686022-77686044 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1141649845 16:85387061-85387083 AGACAGAAAGGAGTGATAGTGGG + Intergenic
1141780069 16:86153400-86153422 AGACAGAGGGAAGCCATTGTAGG + Intergenic
1142605942 17:1081101-1081123 AGACATGGTGCAGAGAGTGTGGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143006672 17:3840681-3840703 AGACAATGTGAAGTGGTTGTAGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144038095 17:11385336-11385358 AGCCAGAGTGTAGTGGTTGGAGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145778963 17:27549497-27549519 AGCCAGAGCCCAGTGTTTGTCGG + Intronic
1146686552 17:34845168-34845190 ATGCAGAGTGCAGTGATGCTAGG - Intergenic
1146744969 17:35320282-35320304 AGCCAGATTGTAGTTATTGTGGG - Intergenic
1147213677 17:38886799-38886821 AGGCACAGTGCAGTGTGTGTAGG + Intronic
1147232032 17:39026683-39026705 AGACCCAGTGAAGAGATTGTAGG + Intergenic
1147312111 17:39601551-39601573 AGCCAGAGTGCAGGGAATGTGGG + Intergenic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150367731 17:64605130-64605152 AGACAGATAACAGTGATTGGAGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151001958 17:70387949-70387971 AGAGAGAGTGCTGTGTCTGTTGG + Intergenic
1151007728 17:70457451-70457473 AGACAGAGAGAATTCATTGTGGG + Intergenic
1153403893 18:4713340-4713362 AGCCAGAGTGCATTGAATGAAGG - Intergenic
1153446642 18:5180144-5180166 TGTCAGAGTGCTGTGATTGAAGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153971572 18:10231880-10231902 AGGCAGGGGGCAGTGATTATAGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155678921 18:28465807-28465829 AGACAGAGTAGAGTGCTTTTGGG - Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1157684207 18:49629644-49629666 AGACAGTGGGTAGTGATCGTAGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159647960 18:70942470-70942492 GGACAGAGCGGAGTGATTGTGGG + Intergenic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1160299059 18:77662850-77662872 AGAAAGAGTTCACTGATCGTAGG - Intergenic
1161335929 19:3713247-3713269 AGACAGAGAGCAGAGATGGAGGG - Intronic
1163790704 19:19304673-19304695 ACACAGACTGCAGTCCTTGTAGG + Intronic
1166963594 19:46514593-46514615 AGACTGAGGGCAGGGGTTGTCGG + Intronic
1168557114 19:57352306-57352328 AGACAGGGGGCAGTGAATGGAGG + Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925670309 2:6303814-6303836 GGACAGACTGCAGTGGTTGGGGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
927241073 2:20919900-20919922 AGTCTGAGTGCAGAGCTTGTTGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
928767855 2:34670003-34670025 AGAAAGAGTGTAGTGACTCTGGG + Intergenic
930049357 2:47202657-47202679 AAATAGAGTCTAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932268796 2:70390918-70390940 AGACAGAGTTCACTGACTGTGGG + Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934039367 2:88115307-88115329 AGTCAGAGTGATGTGATTGCTGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935194347 2:100803362-100803384 AGAAACATTGCAGTGATTTTCGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938190702 2:129277591-129277613 CGAGAGAGTGGAGTGATTGAAGG - Intergenic
938208354 2:129442756-129442778 AGAAAGAGTGTAGTGATCGCAGG - Intergenic
938251033 2:129815941-129815963 AGAAAGAGTGTAATGATTGCAGG + Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939427199 2:142054672-142054694 AGACAGAGTTCACTCACTGTAGG - Intronic
940777101 2:157896560-157896582 AGACAGAGAACAGAGGTTGTGGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941894500 2:170615513-170615535 AGACAGAGGGAAGTGAGTGAGGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943238205 2:185348964-185348986 AGATAGAGGGAAGGGATTGTTGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
946554349 2:220837854-220837876 AGACAGAATGCAGTTTTTCTTGG + Intergenic
948306068 2:236947821-236947843 AAACACAGTACAGTGATGGTAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168852790 20:988143-988165 GGCCAGAGTGCAGTGACTGAGGG + Intronic
1168906125 20:1405182-1405204 AGAGAGAGTCCAGTGGTGGTGGG + Intergenic
1169275282 20:4229653-4229675 GGACAGAATGCAGTGATTGAGGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170051628 20:12152108-12152130 AGACACAATGAAGTGGTTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170485032 20:16807275-16807297 AGAAAGAGTTCAGTGATTGCAGG - Intergenic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG + Intergenic
1173270709 20:41532481-41532503 ATACAGGGGGCAGTGATTTTTGG - Intronic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177247751 21:18551856-18551878 GGACAGAGGGCAGTGGGTGTTGG + Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
1178365539 21:31986346-31986368 AGAGAGAGTGCAGGGGTTGGAGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180133251 21:45841956-45841978 TGACAAAGGGCAGTGATTGAAGG - Intronic
1183983666 22:41557541-41557563 AGCCAGAGAGCAGTGAATGAAGG - Intergenic
1184726976 22:46352878-46352900 GGACAGAGTGCAGCCATTGTTGG + Intronic
949185041 3:1180004-1180026 AGTCAGAGAGCTGTGATTGCAGG - Intronic
949887915 3:8711088-8711110 CTACAGAGAGCAGTGATTGCAGG + Intronic
950567996 3:13782607-13782629 GGCCAGAGTGCAGTGACTGCAGG - Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951846039 3:27085832-27085854 AGACAGAGAGCAGTGTTTAAGGG + Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952187211 3:30982947-30982969 AGACAGAGGGAAGTCATTGAGGG + Intergenic
952677161 3:36046667-36046689 AGACAAAATACAGGGATTGTGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952720247 3:36524739-36524761 GGAAAGAGTGCTGAGATTGTTGG + Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956276535 3:67508028-67508050 AGAAACAGTGCAGTGGTGGTAGG + Intronic
956447571 3:69340516-69340538 AGACATCGTGCAGTGGTTATGGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958151544 3:89699717-89699739 AGACAGAGTGCAGCTCCTGTTGG - Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959361493 3:105399319-105399341 AAAGCTAGTGCAGTGATTGTTGG + Intronic
959750843 3:109832856-109832878 TGATAGAGTGGAGTGATGGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
959914174 3:111797369-111797391 ACACAGAGAGTAGTTATTGTGGG + Intronic
960631894 3:119740808-119740830 TGACAGAGTGATGGGATTGTGGG - Intronic
960701274 3:120441741-120441763 ACACAGTGTGCAGTGTTAGTTGG - Intronic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
961954850 3:130790770-130790792 AAACAGAGTGCTGTAATTCTTGG + Intergenic
962082107 3:132150540-132150562 AGACAGAGAGCAGGGGTTGGGGG - Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
966036789 3:175426868-175426890 AGAGAGAGTGCTGTATTTGTAGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974292181 4:59947478-59947500 AGAAAGAGTGTAGTAATTGCGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977627975 4:99209276-99209298 AGACAGAGAGAAATGGTTGTAGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979203379 4:118005969-118005991 AGACAGAGTGCAGATGTTGGAGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980095390 4:128484715-128484737 ACACAGAGTGCAAAGATTGGTGG + Intergenic
980433958 4:132744072-132744094 AAACAGAGTGCAGTCAGGGTAGG - Intergenic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985142325 4:186854316-186854338 AGACAGTCTGCAGTGATTGGGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
987258604 5:16180893-16180915 AGACACAGAGCAGTCATTTTTGG + Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
988608859 5:32706145-32706167 AGACAGAGTGCAGGGTTGGCAGG - Intronic
991106479 5:62849532-62849554 AGATAAAGTGCATTTATTGTAGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994292842 5:98050517-98050539 AGAACAAGTGCAGTGATTGCAGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995001694 5:107139498-107139520 AGACAGTGTACAGTGCTTGAAGG - Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
995751733 5:115459374-115459396 GGACAGAGTGGAGAAATTGTTGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996665774 5:126058549-126058571 AGACACAGAGCACTGATTGGCGG - Intergenic
997739086 5:136238021-136238043 AGGCAGAGTGCAATGAGTGAAGG - Intronic
998164957 5:139837547-139837569 AGACAGAGAGCAGTGAGGGGAGG + Intronic
998682601 5:144486997-144487019 AGACAGACTGAAGTGATGGAGGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1001124546 5:169007605-169007627 AGACAGGCTGCAGTGTATGTAGG - Intronic
1003592597 6:7448326-7448348 AGACAGAGAGTAGAGAGTGTGGG + Intergenic
1004157024 6:13178773-13178795 AGACAGTGTTCACTGAGTGTTGG - Intronic
1004239381 6:13905081-13905103 AGACAGCAAGAAGTGATTGTTGG - Intergenic
1004425334 6:15503241-15503263 AGGCAGAGTGCAATGAGTGGAGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1008134474 6:47757875-47757897 ACACATAATGCACTGATTGTGGG - Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1008532434 6:52476054-52476076 AGACAGTGTGCAGTGAATGGAGG + Intronic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009321664 6:62298099-62298121 AGAGAGAGAGCAGTGGTGGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1013351532 6:109310304-109310326 AGACAGACTGCAGTGCTTCGAGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014777999 6:125532990-125533012 AGACAGAGAGAAGTGATCCTAGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015612495 6:135039615-135039637 AGATAGAGTGCAGAGTTTGAAGG - Exonic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018570619 6:165205759-165205781 TGCCACAGTGCAGTGATGGTAGG - Intergenic
1019087001 6:169487947-169487969 AGAGAGAGTGCTGTGTCTGTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023267626 7:38424195-38424217 AGATAGAGTTCATTGACTGTGGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023661834 7:42478260-42478282 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1024293350 7:47822687-47822709 AGACTGTGTGCATTGATTGGAGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030118231 7:106080261-106080283 GGCCAGATTGCAGTGAGTGTGGG - Intergenic
1030288896 7:107853024-107853046 AAACACAGTGCAATGATTTTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031009409 7:116509910-116509932 AGAAAGATGGCAGTGATTATGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031300116 7:120054460-120054482 AGACAGAGTGAAGTTATCTTGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031972173 7:128072926-128072948 CGACAGAGTCCAGTGTCTGTGGG - Intronic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033011912 7:137632315-137632337 AGACAGAATCCATTGATTGAAGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034925762 7:155120149-155120171 AGAAAGAGTATAGTGATTGCAGG - Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1035495437 7:159321321-159321343 AGACAGACTGAAGTGTTTGAAGG - Intergenic
1038630122 8:29234102-29234124 ATTCAGAGTGCAGAGATTGATGG + Intronic
1039133545 8:34294804-34294826 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1039434919 8:37553447-37553469 AGACAGTGTGCAGTGTCTGCTGG - Intergenic
1039727532 8:40235230-40235252 AGGCACAGAGCTGTGATTGTAGG - Intergenic
1040293512 8:46137491-46137513 AGAGAGACTGCAGGGATTGCTGG - Intergenic
1041415890 8:57608739-57608761 AGACAGAGTGCAATGACTGGGGG + Intergenic
1041754410 8:61298108-61298130 AGATAGATTGCAATGAGTGTAGG + Intronic
1042375816 8:68050951-68050973 AGACAGAGTTGAGTTATTTTGGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044067992 8:87722181-87722203 AGACACAGAGCACTGATTGGTGG + Intergenic
1044470807 8:92564521-92564543 GGTCAGAGTGCTGTGAGTGTTGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047181031 8:122588318-122588340 AGAAAGAGTGTAGTGGTTGCTGG - Intergenic
1047359574 8:124155814-124155836 AGACAGTGTACTGTGATTGCAGG + Intergenic
1048358257 8:133671777-133671799 AGACGGAGTCCAGTGGTGGTGGG + Intergenic
1048893803 8:138970792-138970814 AGACAGAGTTCAATGATTTCAGG + Intergenic
1049466507 8:142753377-142753399 AGACAGGGGACAGTGATTTTGGG + Intergenic
1049909166 9:248932-248954 TGACAGAGTGAAGTGAGTGAGGG + Intronic
1050760980 9:9070707-9070729 TGCCAAAGTGCAGTGATTATAGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051483957 9:17588268-17588290 AGACAGAATGCTACGATTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053599143 9:39592346-39592368 ATACAGAGTTCAGAGTTTGTAGG - Intergenic
1054568401 9:66783908-66783930 ATACAGAGTTCAGAGTTTGTAGG + Intergenic
1054827008 9:69583274-69583296 GGACAGAGTCCAGTGGTGGTGGG - Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056496805 9:87163936-87163958 ACATAGAGTGAAGAGATTGTTGG + Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057976803 9:99613218-99613240 AGCCTGAGTGCCGTGATTGAGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1058770251 9:108224053-108224075 GGAGACAATGCAGTGATTGTAGG - Intergenic
1059246325 9:112852701-112852723 AGACAGAGTGATGTAATGGTAGG - Intronic
1059431279 9:114251867-114251889 AGACACAGTGCAGTGAGGGTGGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060183096 9:121547250-121547272 ATACAGCGAGCAGTGATTGCTGG - Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061426059 9:130499181-130499203 AGACAGAGTGCTCTGGTTGGTGG + Intronic
1061719478 9:132542850-132542872 AGACAGAGGGCTGGGATTCTTGG - Intronic
1062640753 9:137517005-137517027 GGACAGAGTGGAGTGAGTGGGGG - Intronic
1062640791 9:137517206-137517228 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640825 9:137517409-137517431 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640837 9:137517476-137517498 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640859 9:137517611-137517633 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640883 9:137517746-137517768 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640895 9:137517813-137517835 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640912 9:137517914-137517936 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640943 9:137518082-137518104 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062641012 9:137518481-137518503 GGACAGAGTGGAGTGAGTGGGGG - Intronic
1185749652 X:2600623-2600645 GGACAGAGAGAAGTGATGGTAGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1191930503 X:66366446-66366468 TGACAGAGTGCAGGGATAGTAGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1192882651 X:75303283-75303305 AGACAGAGAGCAATGATCTTTGG - Intronic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194425677 X:93734464-93734486 TGCCAGAGTGCTGGGATTGTAGG + Intergenic
1194675062 X:96784638-96784660 ATACATAGTGCAGGGATAGTAGG - Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195618738 X:106932835-106932857 AGTAAGAGTTCAGTGAGTGTGGG - Intronic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1198700542 X:139392745-139392767 AGAAAGAGTTCAGGGATTGGAGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198999215 X:142613604-142613626 AGACAGAGTGCACAAATTGTTGG + Intergenic
1199163391 X:144641535-144641557 TAACTGAGTGCTGTGATTGTTGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic