ID: 924495614

View in Genome Browser
Species Human (GRCh38)
Location 1:244585707-244585729
Sequence CCTGCTGGACCGAAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924495606_924495614 7 Left 924495606 1:244585677-244585699 CCCACTGGGTGAAGTTAGGCCCT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG 0: 1
1: 0
2: 1
3: 11
4: 131
924495601_924495614 25 Left 924495601 1:244585659-244585681 CCATGGCCTACAGACTGACCCAC 0: 1
1: 0
2: 0
3: 11
4: 196
Right 924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG 0: 1
1: 0
2: 1
3: 11
4: 131
924495604_924495614 19 Left 924495604 1:244585665-244585687 CCTACAGACTGACCCACTGGGTG 0: 1
1: 0
2: 0
3: 14
4: 137
Right 924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG 0: 1
1: 0
2: 1
3: 11
4: 131
924495607_924495614 6 Left 924495607 1:244585678-244585700 CCACTGGGTGAAGTTAGGCCCTT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG 0: 1
1: 0
2: 1
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924495614 Original CRISPR CCTGCTGGACCGAAGGGACA TGG Intronic
900002228 1:21054-21076 CCTCCTGCACGGAAGAGACAGGG - Intergenic
900021947 1:191578-191600 CCTCCTGCACGGAAGAGACAGGG - Intergenic
900252529 1:1678556-1678578 CCTGGTGCACCGAGGGGTCAGGG - Intronic
901087433 1:6619979-6620001 CCTGCTGGACAGAAAGAAAACGG + Exonic
905168462 1:36097179-36097201 CCTGCTGGAGGAAAGGGGCACGG - Exonic
905323717 1:37135315-37135337 CCAGCTGGACTGATGGGAAAAGG + Intergenic
906617290 1:47242076-47242098 CCTGCTGCTCCCAAGGGATAAGG + Intergenic
906698509 1:47840930-47840952 GCTGCTGGACCCATGTGACAGGG + Intronic
914850349 1:151309558-151309580 CCTGTGGGACCAAAGGGTCAGGG + Intronic
918238113 1:182599524-182599546 CCTGCTGCAACGCAGGGTCAGGG + Exonic
920198670 1:204245808-204245830 CCTGCTGGCCCAAAGGGATGTGG - Intronic
920965442 1:210697266-210697288 CCTGCTGGGCCCAAGAAACATGG + Intronic
924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG + Intronic
1065993053 10:31031656-31031678 CCTGCTGGGCGGTAGGGACCTGG - Intronic
1070848103 10:79540305-79540327 CCTGCTGGACGTAAGGGCCCAGG - Intergenic
1070925674 10:80219864-80219886 CCTGCTGGACGTAAGGGCCCAGG + Intergenic
1073147133 10:101288351-101288373 CCAGCTGGAAAGAAAGGACATGG + Intergenic
1077094782 11:794671-794693 CCTGTTTGACAGAAGGGAAACGG - Intronic
1082765352 11:57163377-57163399 CCTGCCAGACGGCAGGGACAAGG + Intergenic
1083180040 11:60979366-60979388 CCTGCTGGCCCCAAGGTGCAGGG - Intronic
1085253531 11:75159380-75159402 CCTGCGGGAATGAAGGGACCTGG - Intronic
1085665853 11:78415643-78415665 CCTGATGGGCTGAAGGTACATGG + Intronic
1091277660 11:134363177-134363199 GCTGCTGGAGGGCAGGGACAGGG + Intronic
1091375646 12:23115-23137 CCTCCTGCACGGAAGAGACAGGG - Intergenic
1091843127 12:3634441-3634463 TCTGCTGGGCCCAAGAGACAGGG - Intronic
1093094774 12:14960022-14960044 CCTGTTGGTCCGGAGAGACAGGG - Intronic
1094160249 12:27382554-27382576 TCTGCTGAACAGAAGTGACATGG + Intronic
1095086851 12:38066064-38066086 CTTGCCGGCCAGAAGGGACATGG + Intergenic
1095751855 12:45721403-45721425 CCTACTGAACTGAAGGGAAAGGG - Intergenic
1099970446 12:89494763-89494785 CCTGCTGGAGAGACGGCACATGG + Intronic
1103719251 12:122964720-122964742 CCTGCTTGGCCTGAGGGACAAGG + Intronic
1105839692 13:24243382-24243404 ACTGCTGGAGGGAGGGGACAGGG - Intronic
1109406260 13:61903705-61903727 CCTGATGGGCCGAATAGACAAGG + Intergenic
1123579066 15:21699917-21699939 CCTGCAGGGCCAAAGGGACTGGG - Intergenic
1123615693 15:22142399-22142421 CCTGCAGGGCCAAAGGGACTGGG - Intergenic
1126023896 15:44427614-44427636 CCTGCTGCACCGCACGGACAGGG - Exonic
1126100927 15:45117786-45117808 CCTTCTGGACCAAAGCGCCAAGG + Exonic
1127437788 15:58975198-58975220 CGTGCTGGACCGAAGGAATGAGG + Intronic
1129826633 15:78638776-78638798 CCTGCTGGGCTCAAAGGACAAGG + Intronic
1130557864 15:84935527-84935549 CCTGCTGCAGGGAAGGGACTGGG - Intronic
1131208705 15:90474531-90474553 CCTGCTGGACCAAAGTGACCAGG + Exonic
1202987936 15_KI270727v1_random:434162-434184 CCTGCAGGGCCAAAGGGACTGGG - Intergenic
1132654675 16:1036836-1036858 AGCGCTGGACCGCAGGGACATGG - Intergenic
1132866293 16:2094201-2094223 AGTGCTGGACCTGAGGGACATGG + Exonic
1134682232 16:16134328-16134350 CCTGCAGGACAGAAGGGCCCAGG - Exonic
1136990560 16:35148935-35148957 CCTGCTCGAAGGAAGGGACCTGG + Intergenic
1137018888 16:35402905-35402927 CCTCCATGACAGAAGGGACAAGG - Intergenic
1139922128 16:70467161-70467183 CCTGTGGGACAGAAGGGGCAGGG - Intronic
1142033618 16:87850681-87850703 CCTGCTGGACTCAAGCAACAGGG + Intronic
1142147294 16:88497926-88497948 CCTGATGGACAGCAGGGAGATGG + Intronic
1142605055 17:1076872-1076894 CCTGCAGGAGCCCAGGGACAGGG - Intronic
1143469759 17:7165227-7165249 CCTCCAGGACCGCAGGGAGAGGG - Intergenic
1146280461 17:31541171-31541193 CCTGCTGCTCCCAAGGGACCTGG - Intergenic
1147015884 17:37490720-37490742 CCTGCTGGATAGAAAGTACAAGG - Intronic
1148069762 17:44901663-44901685 CCTGCTGGACTAAAGGGGCAGGG - Intronic
1150271737 17:63871262-63871284 CCATCAGGACTGAAGGGACACGG - Intergenic
1150620765 17:66806418-66806440 CCTGCAGGGCTGCAGGGACAGGG - Exonic
1151383884 17:73743478-73743500 TCTGCCGATCCGAAGGGACAGGG - Intergenic
1152129447 17:78467141-78467163 CCTGCTGAACCGAAGGGCTTGGG - Intronic
1152902016 17:82947694-82947716 CCTGCTGGGCCCAAGGACCAAGG - Intronic
1153003552 18:477903-477925 CCTGCTGCATGGAAGGGACTTGG + Intronic
1153135556 18:1913390-1913412 CCAGCAGGAACGCAGGGACAGGG + Intergenic
1154164440 18:12003889-12003911 GCTGCTCCACAGAAGGGACAAGG - Intronic
1154218277 18:12431552-12431574 TCTGCAGGACCGAGGGGACGGGG - Exonic
1156005859 18:32439974-32439996 CCCGCTGGTCCTAAGGGACTAGG - Intronic
1157592347 18:48843314-48843336 CCTGCTGGAGCGCAGGGCCCTGG - Intronic
1159892654 18:73967107-73967129 CCTGGTGGACCCAATGGACATGG - Intergenic
1160444339 18:78915401-78915423 CCTGCTGGCCACAAGGCACACGG - Intergenic
1160633981 19:62662-62684 CCTCCTGCACGGAAGAGACAGGG - Intergenic
1161808392 19:6458157-6458179 CCTGCAGGCCCCAAGGGATAGGG - Intronic
1162936681 19:13984758-13984780 CCGGCAGGACTGAAGGGCCACGG + Intronic
1163260903 19:16189369-16189391 CCTGCTGGAAAGAAAGGACCTGG - Intronic
1163762986 19:19147056-19147078 GCTGCTGGTCGGAAGGGAGATGG + Exonic
1165855980 19:38879493-38879515 CCTGCTGCACCGCAGGGACGTGG - Exonic
927726231 2:25425506-25425528 CCTCCAGGCCCGAAGTGACAAGG - Intronic
930000151 2:46855953-46855975 GCTGCTGGGCTGAAGGGACTGGG + Exonic
935246880 2:101226466-101226488 CCTCCTGGATGGCAGGGACAGGG + Intronic
936024010 2:109017371-109017393 GCTGATGGACAGCAGGGACAGGG - Intergenic
936052431 2:109235024-109235046 CCTACTGGGCTGAAGGGACCAGG - Intronic
936567499 2:113592366-113592388 CCTCCTGCACGGAAGAGACAGGG + Intergenic
938762269 2:134436614-134436636 CCTGCTGGACCTGAGGTGCAAGG + Intronic
940457017 2:153913766-153913788 GATGCTGGACTGAAGGGAGAGGG - Intronic
942026280 2:171913678-171913700 CCTGCTGGAGAGAAGTGAGAGGG + Intronic
943525095 2:189006405-189006427 CCAGCTGGACCGACAGGACCAGG - Exonic
1168993677 20:2116334-2116356 GCTGCTGGGCAGATGGGACAAGG - Intronic
1169971124 20:11270537-11270559 CCTGCTGGAACTCAGGGAGATGG + Intergenic
1170716491 20:18835911-18835933 CCTGATGGAGTAAAGGGACAAGG + Intergenic
1172229545 20:33327577-33327599 CATGCTGGACGGCAGGGGCATGG - Intergenic
1173182682 20:40816519-40816541 CCTGCCAGACTGAAGGGGCAAGG - Intergenic
1176521230 21:7826071-7826093 CCTGCAGGATCAATGGGACAGGG - Intronic
1177133859 21:17290059-17290081 CCTGCTGCACTGGAGGGGCAAGG - Intergenic
1178655250 21:34456083-34456105 CCTGCAGGATCAATGGGACAGGG - Intergenic
1179130129 21:38628709-38628731 GCTTCTGGAGGGAAGGGACAGGG - Intronic
1180191686 21:46168386-46168408 CCTGCTGGAGCCCAGGGAGATGG - Exonic
1181475271 22:23164204-23164226 CCTGGAGGCCCGAAGGGGCAAGG - Exonic
1181570910 22:23767508-23767530 CCGGCTGGCCCGAAGGGGCGGGG + Exonic
1182357986 22:29730816-29730838 TCTGCTGGTCCCAAGGGAGAAGG + Exonic
1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG + Intronic
950646203 3:14378327-14378349 CCTGCTGGCCCCAAGGGACATGG - Intergenic
952903705 3:38126282-38126304 CCTGCTGGCCCGGAGGTCCAAGG - Exonic
960948503 3:122983123-122983145 CCTGCTGGTCAGAAGAGGCAAGG + Intronic
961433183 3:126897810-126897832 GCAGCTGGAGGGAAGGGACAGGG - Intronic
962677383 3:137766978-137767000 CCTGCAGGAGCAAAGGGAAAAGG + Intergenic
963637030 3:147810961-147810983 CCTTCAGGAACGAAGGGGCAAGG + Intergenic
967941612 3:194770749-194770771 TCTGCTGGGCGGGAGGGACATGG - Intergenic
968977732 4:3830680-3830702 CCAGCTGGAGGGAAGGGGCAGGG + Intergenic
969207157 4:5655597-5655619 CCTGCACCACCCAAGGGACAGGG + Intronic
969525402 4:7701635-7701657 CCTGCTGGACACCAGGGCCAAGG + Intronic
976253355 4:83075836-83075858 TCTGCTGAACCGAAGGAAAAGGG - Intergenic
980054881 4:128069632-128069654 GCTGCTAGACAGAAGGGGCACGG + Intronic
981419673 4:144534720-144534742 TCTGCTGCACAGAAGGGTCATGG - Intergenic
982785848 4:159535961-159535983 CCTGCAGGACAGAAGGAATAGGG - Intergenic
992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG + Intronic
992426056 5:76658505-76658527 CCTGCTGGACCAAAGTGATTTGG + Exonic
992703376 5:79362977-79362999 CCTGCTGGAGCAGTGGGACACGG + Intergenic
998005254 5:138652523-138652545 CCTCCTGGACTGAAAGCACAGGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999151706 5:149430594-149430616 CCAGCTGGTCCTTAGGGACACGG + Intergenic
1011557703 6:88587242-88587264 CCTGCTGGACCGTGGGGAAAGGG + Intergenic
1017634530 6:156430907-156430929 CCTGTTGGCCAGAAGGGAAAAGG + Intergenic
1017915171 6:158825989-158826011 TCTGCTGGACTGGAGGCACAGGG - Intergenic
1021790451 7:24199446-24199468 CCTGCTGGATGGGATGGACAAGG - Intergenic
1023741766 7:43287411-43287433 GTTGCTGGACCCAAGGGAAAAGG + Intronic
1027853234 7:83475593-83475615 CCTGCAGGACCGGAGGGGCAAGG + Intronic
1033074163 7:138233093-138233115 CCTGGTGGACCGAACGAAGAGGG + Intergenic
1034337140 7:150330884-150330906 CCTGCTGGCCCAGAGGGAGAAGG + Exonic
1035746275 8:1963804-1963826 CCTGCTGGGCCTCTGGGACAGGG + Intergenic
1036014847 8:4771688-4771710 CATGCTGGACACAGGGGACACGG - Intronic
1037809775 8:22080596-22080618 CCTGCGGGAGAGAAGGGGCATGG - Exonic
1043077103 8:75715881-75715903 CCTGGTGGACCGAGTGGACAGGG + Intergenic
1047643803 8:126849101-126849123 CCAGCTAGACAGAAGAGACAGGG + Intergenic
1048442250 8:134468741-134468763 CCAGCGGGAACGAAGGGCCAGGG + Intergenic
1049265929 8:141667907-141667929 CCTGCTGCACCCAGGGGACCTGG - Intergenic
1049545230 8:143227737-143227759 CCTGCTGGACCCATGGGACCTGG + Intergenic
1049586354 8:143434382-143434404 CCTGCTGGCCCGAGGCGTCAGGG - Intergenic
1049885035 9:21167-21189 CCTCCTGCACGGAAGAGACAGGG - Intergenic
1051604962 9:18909583-18909605 GCTGCTCCACCGAAGGGCCAGGG + Exonic
1057222181 9:93263366-93263388 CCTGCTGCACCCAAGTGGCACGG - Intronic
1059994658 9:119897058-119897080 CCTTATGGACAGAAGGGACTGGG - Intergenic
1062273482 9:135720216-135720238 CCAGCTGCCCCGCAGGGACAGGG + Intronic
1194026441 X:88758077-88758099 CCTGCTGGACCCAAGGGCAGAGG + Intergenic
1195541789 X:106070299-106070321 CCTGCTGCACCGTATGTACAGGG - Intergenic
1201772973 Y:17635839-17635861 CTTGCTGGCCAGAAGGGACATGG - Intergenic
1201828582 Y:18270147-18270169 CTTGCTGGCCAGAAGGGACATGG + Intergenic