ID: 924498457

View in Genome Browser
Species Human (GRCh38)
Location 1:244613013-244613035
Sequence ACATTAGGAAATAAGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924498457 Original CRISPR ACATTAGGAAATAAGGAAAT AGG Intronic
900111702 1:1009379-1009401 GCATTAAGAAATCAGGAAACGGG + Intergenic
900846144 1:5102975-5102997 AAATTAGAAAATAAGCATATGGG + Intergenic
902354107 1:15883768-15883790 ACATTAGGAAAAAAAGTAATAGG - Intronic
902958512 1:19944173-19944195 ACATTATCAAATAAGGGAGTTGG - Intergenic
903366293 1:22807260-22807282 ACCTTAGGAAGGAAGGAAAAGGG + Intronic
903811745 1:26038545-26038567 AGCTGAGGAAATAAGGAAAGAGG + Exonic
904101667 1:28035026-28035048 ACATAAGGTTATAAGAAAATTGG + Intronic
907218901 1:52890532-52890554 ACAATAGAAAATAATGAAAATGG - Intronic
907736283 1:57115794-57115816 GCTTTGGGTAATAAGGAAATGGG + Intronic
909221390 1:72966004-72966026 TCATGAGAAAATAAAGAAATTGG + Intergenic
909440022 1:75686703-75686725 GAAGTAGGAAATCAGGAAATTGG + Intergenic
909629646 1:77758693-77758715 ACAGTAGGAAAAACGGAACTAGG + Intronic
909867501 1:80692708-80692730 AAATAAGGAGAGAAGGAAATAGG - Intergenic
911269217 1:95780313-95780335 AAATTAGGAAATGAGGATAATGG - Intergenic
911419746 1:97625623-97625645 ACAGGAGGAAATTAGGACATAGG + Intronic
912102186 1:106223384-106223406 AGATGATGAAATAAGGAAGTAGG - Intergenic
912563571 1:110567783-110567805 ACATTAGCAAATAAAGTAAATGG + Intergenic
912710545 1:111946596-111946618 AGGTTAGAAAATAAGGAAACAGG - Intronic
912909324 1:113741852-113741874 CCTTTAGGAAATAAAAAAATGGG - Intronic
913237340 1:116796337-116796359 TCATCAGGAAATGAGGAAACAGG + Intergenic
913467750 1:119159581-119159603 ACATTAGACAGTGAGGAAATGGG - Intergenic
913502606 1:119484920-119484942 ACATGAGGAAATAAAGAAATAGG - Intergenic
914901788 1:151715063-151715085 AGATGAGGAAATAGGGAAAATGG - Intronic
915233294 1:154462061-154462083 ACTTTTTGCAATAAGGAAATGGG + Intronic
916070144 1:161165337-161165359 ACACTAGGAAAAAAGGAGATCGG - Exonic
916362101 1:163982183-163982205 GCATCAGGAAATAAGCACATAGG + Intergenic
918220041 1:182428365-182428387 GGATTAGGAAATTTGGAAATGGG + Intergenic
918618459 1:186575360-186575382 AAAGTAGGAAATAAGGAGATAGG + Intergenic
919338430 1:196269530-196269552 AAATTAGGAATTAAGAATATGGG + Intronic
919734879 1:200941302-200941324 AAAATAGAAAATAAGAAAATAGG - Intergenic
919845721 1:201640967-201640989 ACATTAGGAAATGATTAAAGTGG + Intronic
920357371 1:205384091-205384113 ATATTTAGAGATAAGGAAATAGG - Intronic
921171543 1:212554372-212554394 TAATTAGGACATAAGGAAACAGG - Intergenic
921350934 1:214233678-214233700 ACATTAGCAAAAAGGGAAAAAGG + Intergenic
921402732 1:214744092-214744114 ACATGAGGAAGGAAGGAAAATGG - Intergenic
921506145 1:215972717-215972739 AAATTTGGAAATAAGGGAAATGG - Intronic
922564433 1:226592347-226592369 ACATTAAAAAATAAGGAAAAAGG - Intronic
922853985 1:228758265-228758287 AATATTGGAAATAAGGAAATGGG - Intergenic
923258288 1:232241357-232241379 ACAGGATGAAATAAGGAAACTGG + Intergenic
924181518 1:241443576-241443598 ACATTAGCAAACAAGGAAGTTGG - Intergenic
924236683 1:242004956-242004978 ACAAAAGGAAAAAAGAAAATGGG - Intergenic
924498457 1:244613013-244613035 ACATTAGGAAATAAGGAAATAGG + Intronic
1062886334 10:1019324-1019346 AAATATGGAAATAAGGAAAAGGG + Exonic
1063019671 10:2114954-2114976 ATAATAAGAAATAAAGAAATCGG + Intergenic
1064479895 10:15729105-15729127 ACAATAGTAAATAATAAAATGGG - Intergenic
1064668889 10:17687639-17687661 ACATTAAGAAGTCAGGAATTTGG + Intronic
1064816728 10:19273889-19273911 ACATGATCAAATAAGGAAAATGG + Intronic
1067195587 10:44115077-44115099 ACATTAGGGAATAGGAAAATTGG + Intergenic
1067196424 10:44123396-44123418 AGATAAGGAAAGAAGGAACTAGG + Intergenic
1067326716 10:45275540-45275562 ACAAGTGGAAATAAAGAAATAGG - Intergenic
1067541281 10:47156091-47156113 TCATTAGGATATAAGGATATAGG - Intergenic
1067929909 10:50550340-50550362 TCATTGGGAAATTTGGAAATGGG - Intronic
1068026946 10:51657983-51658005 ACTTTAAGAAATAAGCAAAAAGG + Intronic
1068038091 10:51786359-51786381 ATAAAAGGAAATAAGGAAATAGG + Intronic
1068979386 10:63045465-63045487 ACATTAAAAAATAGTGAAATAGG + Intergenic
1069268863 10:66498625-66498647 ACATTAGGTAATAAAGATCTTGG + Intronic
1069288955 10:66752722-66752744 ACAATACAAAATAAGAAAATAGG + Intronic
1069429985 10:68325667-68325689 ACATTGTAAAATAAGGAAGTAGG - Intronic
1070268894 10:74932624-74932646 TCATTAGAAAATGAGGGAATGGG + Intronic
1072134225 10:92528093-92528115 TCATATGGAAATAAGGAAATAGG + Intronic
1072958682 10:99909684-99909706 ACACTAGCATATAATGAAATAGG + Intronic
1073272457 10:102276825-102276847 CAATTAGGTAAAAAGGAAATAGG - Intronic
1074421376 10:113311788-113311810 ACTTAAGGAAAAAAGGAATTTGG - Intergenic
1075107270 10:119548593-119548615 ACCTTAGGAAATAATGATCTTGG + Intergenic
1075813241 10:125244120-125244142 ACATAAGTAAATAATTAAATTGG + Intergenic
1075880200 10:125844572-125844594 ACATTAATAAATAACTAAATAGG + Intronic
1076487009 10:130828538-130828560 AGAATAGGAAATAAAAAAATTGG + Intergenic
1076510399 10:131009927-131009949 ACATTTAGAAATCAGGAAACAGG + Intergenic
1077777826 11:5291280-5291302 ATATTAGGAAAAAGGGAAACTGG + Intronic
1079934315 11:26598453-26598475 ATGTTAGGATACAAGGAAATAGG + Intronic
1080026543 11:27621171-27621193 ATATTAGGTAATTAGGAATTTGG + Intergenic
1080085534 11:28277395-28277417 ACCTTAAGAAAGAATGAAATTGG + Intronic
1080241149 11:30128532-30128554 ACATTAAGAAATAAGACAGTGGG - Intergenic
1080393776 11:31871676-31871698 ACTTTATGTGATAAGGAAATGGG + Intronic
1080430799 11:32197499-32197521 ACACTGTGAAATACGGAAATGGG - Intergenic
1080774269 11:35371196-35371218 ACAATGGGAAACAAGGAAATGGG - Intronic
1080975948 11:37340656-37340678 ACAGTGGGACATAAGGAAAGAGG - Intergenic
1081247383 11:40785504-40785526 ACATTATAAAAAGAGGAAATGGG - Intronic
1081384580 11:42456555-42456577 TCATTACCAATTAAGGAAATTGG + Intergenic
1081501864 11:43674905-43674927 ATAATAGGACATAAGGAAAGAGG - Intronic
1081586278 11:44386150-44386172 GCATTGGGAAATAAGCTAATAGG + Intergenic
1081608224 11:44540998-44541020 ACAGTGGGAAACAAGGACATAGG + Intergenic
1082702120 11:56444744-56444766 GGATTAGGAAATAAGAAATTTGG + Intergenic
1082704253 11:56474016-56474038 GGATTAGGAAATAAGAAATTTGG - Intergenic
1083039789 11:59674413-59674435 AAACTTGGAAATAAGGAAAAAGG + Intergenic
1084522366 11:69671970-69671992 AAATTAGGAAATTAGGTCATCGG + Intronic
1084995149 11:72969508-72969530 ACACAAAGAAGTAAGGAAATGGG - Intronic
1085008386 11:73116242-73116264 AAATTAAGTAATAATGAAATTGG - Intronic
1085778479 11:79387702-79387724 ACATTAGAAAATAAACAAACAGG + Intronic
1085859076 11:80211230-80211252 ACATGATGAAATAAAGAAACAGG + Intergenic
1085993163 11:81876298-81876320 ACAGGAGGAAAGAATGAAATAGG - Intergenic
1086043591 11:82507330-82507352 ATATTAGGAAATCAGGTACTTGG + Intergenic
1086913210 11:92496762-92496784 ACTTTAGGAAAGGAGGAAAGGGG + Intronic
1087020860 11:93601717-93601739 AAATTAGGAAATTAGGGATTAGG + Intergenic
1087233481 11:95692492-95692514 AATTTAGGAAATAAGAAAACAGG - Intergenic
1088037953 11:105340854-105340876 AGATTAGTAAATAAATAAATAGG + Intergenic
1089040522 11:115444706-115444728 ATATTTGTAAATAAGAAAATGGG - Intronic
1089123106 11:116154736-116154758 ACATTAGGAAAGAAGGAAAAAGG + Intergenic
1089231301 11:116979330-116979352 AAATTAGGAAAAATGGAAATAGG - Intronic
1089289596 11:117429672-117429694 AGTTTAAGAAATAAGGAACTAGG - Intronic
1089958148 11:122591596-122591618 AAATAAGGAAAAAAAGAAATGGG + Intergenic
1090516620 11:127435275-127435297 ATATCAGGAAAAAAGGAACTTGG - Intergenic
1090731055 11:129573807-129573829 ACTTAAGGAAATAAGGTAATAGG - Intergenic
1090968549 11:131619768-131619790 AAAATAGCAAATAAGGATATGGG + Intronic
1091245984 11:134094925-134094947 ATATTAATAAATGAGGAAATAGG + Intronic
1092036960 12:5344439-5344461 AGATTAGGAAATAGGGAAGAAGG - Intergenic
1092192591 12:6531910-6531932 TCATTAGAAAACAAGGAGATTGG - Exonic
1092531036 12:9345498-9345520 ACATCAGGAAAAAATGAATTTGG + Intergenic
1093678878 12:21977057-21977079 AGATTAGGAGATAGGAAAATTGG - Intergenic
1093678941 12:21977879-21977901 AGATTAGGAGATAGGAAAATTGG - Intergenic
1094150726 12:27279971-27279993 ACATTTACAAATAAGGAAGTAGG - Intronic
1094247149 12:28311550-28311572 AAACTTGGAAATAAGGAAAAAGG + Intronic
1095624406 12:44297503-44297525 AAAGTGGGATATAAGGAAATTGG + Intronic
1096778868 12:53980534-53980556 AAAGAAGGAAACAAGGAAATGGG + Intergenic
1096793825 12:54061646-54061668 ACAGGAGGAAATATGGAACTTGG - Intergenic
1097019672 12:56011318-56011340 ACATAAGGAACTAAGGAAAAGGG - Intronic
1097188718 12:57209444-57209466 ACATTAGGAACGTAGCAAATTGG + Intronic
1097533019 12:60829485-60829507 AAATTAGGAAATAACCAACTGGG - Intergenic
1097548913 12:61041773-61041795 AAATTAGTAAACAAGAAAATGGG + Intergenic
1097623827 12:61975548-61975570 AGATGAGTAAATAAAGAAATTGG - Intronic
1098216366 12:68224535-68224557 ACATAAGTAAATAAGAAAAAGGG + Intronic
1099058603 12:77877609-77877631 CCATTAGGAAATAAATAAATGGG + Intronic
1099153741 12:79148161-79148183 ACATTAGGAGAAAAGAAAATTGG + Intronic
1099274977 12:80563457-80563479 ACATTAGGATATAAGGCCTTTGG - Intronic
1099411357 12:82332524-82332546 AAATTTGGAAATAAGGCAAAGGG + Intronic
1100584039 12:95962792-95962814 TAATTAGTAAATAATGAAATAGG + Intronic
1100623602 12:96306264-96306286 CCATTAGAAAATATGAAAATAGG + Intronic
1100878108 12:98984699-98984721 CCATTAAAATATAAGGAAATAGG - Intronic
1101437546 12:104677041-104677063 AGATGAGGAAAGGAGGAAATGGG - Intronic
1102269522 12:111521080-111521102 AAATTAGCAAATTAGAAAATAGG + Intronic
1104166169 12:126231832-126231854 ACATGAGTGAACAAGGAAATGGG - Intergenic
1105483662 13:20804299-20804321 AAAATAAGAAATAAGAAAATAGG - Intronic
1106798323 13:33230645-33230667 ACATGAGGATAACAGGAAATAGG - Intronic
1107303453 13:38992276-38992298 ACATCAGAAAATTAGAAAATTGG - Intergenic
1107413091 13:40175575-40175597 ACCTTAGGAAGTAAGGGAAGAGG + Intergenic
1107519634 13:41167111-41167133 AAATTAGAAAATAAAGATATAGG + Intergenic
1107827984 13:44347487-44347509 TCTGTAGGAAATTAGGAAATGGG + Intergenic
1107835217 13:44407477-44407499 TGATGAGGAAACAAGGAAATGGG + Intergenic
1109383330 13:61594954-61594976 ATATTAGAAAATAAGAAAAAAGG - Intergenic
1110139230 13:72106645-72106667 AAATGAGGAAATAATGGAATGGG + Intergenic
1110212963 13:72994297-72994319 ATATTAGGTAATAAGGAAAAAGG + Intronic
1110348436 13:74476763-74476785 AAATTTTGAAATAAGGCAATTGG - Intergenic
1110770059 13:79331877-79331899 AAAATAGAAAATAAGGTAATAGG + Intronic
1110947004 13:81434669-81434691 ACATCAAGAAGTAAGTAAATCGG + Intergenic
1111455437 13:88477224-88477246 AAATTTGGAAATAATGAACTAGG + Intergenic
1112703373 13:102037567-102037589 ATAGGAGGAAATAAGGGAATGGG + Intronic
1112717061 13:102198962-102198984 ACATTTAGACATAAGGATATTGG - Intronic
1114431125 14:22661884-22661906 TAATAAGGAAATAAGCAAATGGG - Intergenic
1115012039 14:28559951-28559973 TCATTAAAAAATAAGTAAATAGG + Intergenic
1115215519 14:31010141-31010163 AAATCAGTAAAAAAGGAAATAGG + Intronic
1115414412 14:33114334-33114356 ACATTAAAAAATCAGGAACTAGG - Intronic
1116083958 14:40210998-40211020 ACAATGGGAAAAAAGGATATAGG - Intergenic
1117673907 14:58136887-58136909 ACATTTAGAAATAAGGAAGGGGG - Intronic
1119549790 14:75500207-75500229 ACAATGGTAAATAAGTAAATAGG + Intergenic
1120204085 14:81568903-81568925 ATATAATGAAATAAGGAAATAGG + Intergenic
1120228491 14:81817828-81817850 ACAATAGGACATAAAGACATTGG - Intergenic
1120470051 14:84911669-84911691 AGATTAGGACAGGAGGAAATAGG + Intergenic
1122319788 14:100847440-100847462 ATATTGGTAAATAAAGAAATAGG + Intergenic
1123568413 15:21576342-21576364 ACATTAGGAAATTATGGAAACGG + Intergenic
1123604521 15:22011664-22011686 ACATTAGGAAATTATGGAAACGG + Intergenic
1123761385 15:23435551-23435573 ACATTAGTAAGTAAATAAATAGG - Intergenic
1123858860 15:24442447-24442469 ACATTATGAAATAATGAAAGTGG - Intergenic
1123997081 15:25726394-25726416 ACATTTGGAAACTAGGAAAATGG - Intronic
1124944605 15:34252431-34252453 ACATTAAAAAAAAAGGAAACAGG + Intronic
1124998554 15:34747644-34747666 AAATTATGAAAGAAGGAAAAGGG - Intergenic
1125369641 15:38959151-38959173 ACATTAGGAAATAAGCATTTTGG - Intergenic
1125802705 15:42464401-42464423 ACATTGGGAACCTAGGAAATAGG - Intronic
1126426629 15:48534439-48534461 ACATTAGGAAACATGGAAGGTGG - Intronic
1126458487 15:48890361-48890383 ACATTATAAAATGTGGAAATTGG + Intronic
1126839578 15:52704093-52704115 ATATCAGAAAATAAAGAAATTGG + Intronic
1127443233 15:59033092-59033114 AAATTAGGGAATAGGGTAATGGG + Intronic
1127512333 15:59655321-59655343 AAAATAGGAAAAAAGGAATTGGG - Intronic
1127603191 15:60559539-60559561 AAGTTAGGAAGTAAGCAAATAGG - Intronic
1128318848 15:66678761-66678783 ACATGAGGAAATAAGGATCTTGG + Intronic
1128937994 15:71764440-71764462 ACATTAGGAAACAAGAAGATTGG + Intronic
1129218506 15:74116626-74116648 ACATCAAAAAATAAGAAAATAGG - Intronic
1130019755 15:80218437-80218459 GCAATAAGAAATAAGCAAATAGG - Intergenic
1130400531 15:83548286-83548308 ACAAATGGAAATAAGAAAATAGG - Intronic
1132134112 15:99316454-99316476 GAATTAGGGAATAAGGAAATAGG + Intronic
1202976769 15_KI270727v1_random:303429-303451 ACATTAGGAAATTATGGAAACGG + Intergenic
1132531528 16:452732-452754 AAATTAAAAAATAAAGAAATAGG - Intronic
1132531576 16:453052-453074 AAATTAAAAAATAAAGAAATAGG - Intronic
1133950764 16:10390480-10390502 AAATTAGAAAAAAAGGTAATAGG + Intronic
1134822539 16:17258319-17258341 AAATAAGGAAGAAAGGAAATAGG + Intronic
1135583586 16:23649410-23649432 ACAAAAGGAAATAAACAAATGGG - Intronic
1136602722 16:31306215-31306237 TCATTAGGACACAAGGAAAAAGG - Intronic
1137293822 16:47071090-47071112 GCATTAAAAAAGAAGGAAATCGG + Intergenic
1137857067 16:51805449-51805471 ACGCCTGGAAATAAGGAAATGGG - Intergenic
1137915907 16:52429664-52429686 GCATTAGGAATCATGGAAATTGG + Intergenic
1138150028 16:54648340-54648362 ACTTTAGGAAATTATAAAATGGG - Intergenic
1138306245 16:55978346-55978368 AGATTTGGACATCAGGAAATAGG - Intergenic
1139206586 16:65034922-65034944 ACTTGAGGAAATGAGGAGATGGG - Intronic
1139500938 16:67364773-67364795 AGTTTAAGAAATAAGGAAGTGGG + Intronic
1139656607 16:68391021-68391043 AGATTAGGACATAAGCTAATGGG + Intronic
1140258985 16:73361003-73361025 ATAAAAGCAAATAAGGAAATGGG + Intergenic
1140558685 16:75951720-75951742 AGATTTGGAAATAATGAATTTGG - Intergenic
1142838849 17:2611167-2611189 ACATTAAGAAATATAGAAAAGGG + Intronic
1142898350 17:2996479-2996501 TTCTTAGGAAAGAAGGAAATTGG + Intronic
1144159482 17:12543509-12543531 ACATTAGCAATAAGGGAAATTGG - Intergenic
1144430384 17:15185745-15185767 ACATTAGGCAATAACGGTATGGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1146150520 17:30465352-30465374 ACAGTAGGAAATGAATAAATGGG + Exonic
1147532345 17:41291331-41291353 ACAATAGGAAATAATTGAATTGG + Intergenic
1149187309 17:54014744-54014766 ATATTAAGAAATAAAGAAAAGGG + Intergenic
1149290953 17:55216925-55216947 GCATAAGGAAATAAGAAAAGAGG - Intergenic
1149309452 17:55379772-55379794 ACATTTGGGAATAAGGAACAAGG + Intergenic
1149467284 17:56890248-56890270 ACATTAGGCTATAAGGAGCTTGG + Exonic
1150080004 17:62229102-62229124 ACATTAGTAAAAACGAAAATAGG - Intergenic
1150357488 17:64499315-64499337 ATACTAGCAAATAAGGAAAAAGG + Intergenic
1150880487 17:69020068-69020090 ACCTTGGGAAAAGAGGAAATGGG + Intronic
1151573523 17:74939328-74939350 ACATTAGGAAGCAAGAGAATGGG + Intronic
1152761921 17:82113021-82113043 ACATTAAGAAATAACCAAATCGG - Intronic
1153522483 18:5965840-5965862 ACAGTAGGGAATAATGAAAATGG + Intronic
1153910480 18:9702128-9702150 AAAATAGGAAATAAGAAAAGAGG - Intergenic
1153918068 18:9763488-9763510 ATATTAGGAAATGAATAAATAGG + Intronic
1153951343 18:10060260-10060282 CCATTTGGAAATGAGGAAATGGG - Intergenic
1154128053 18:11711765-11711787 ACATGAAGAAAGAGGGAAATGGG - Intronic
1155311846 18:24531974-24531996 ACATGAGGAAACAAGAAAACAGG - Intergenic
1156279451 18:35620987-35621009 CTAGTAAGAAATAAGGAAATGGG - Intronic
1156399310 18:36726586-36726608 AAATTTGAAAATAAGGAAATTGG - Intronic
1156411341 18:36830436-36830458 GAATTAGGAAGTTAGGAAATTGG + Intronic
1156600502 18:38600113-38600135 AAATTAGGGAATATGTAAATAGG - Intergenic
1156991548 18:43414649-43414671 ACATTCCGAAATAAGGAATTTGG - Intergenic
1157088553 18:44607752-44607774 ACATTAGGAAATTCTGAATTAGG - Intergenic
1157115958 18:44863101-44863123 ACAGAAGGAAATCTGGAAATTGG - Intronic
1157187096 18:45549938-45549960 ACATTTGGAAACTAGGAATTGGG - Intronic
1158551831 18:58442704-58442726 AAAATAAGAAATAAGTAAATAGG - Intergenic
1158736600 18:60089506-60089528 ACATTTTGAAATAAGGCAAACGG - Intergenic
1158991939 18:62877847-62877869 ATATGAGGGAATAAGAAAATGGG - Intronic
1159988626 18:74875549-74875571 ACATGAGGAAATAAGTAGATAGG + Intronic
1161464846 19:4423341-4423363 ACTTGAGGAAAAAAGGAAAAAGG + Exonic
1161728241 19:5943181-5943203 ATTTTAGAAAATAAGAAAATTGG - Intronic
1164775793 19:30852598-30852620 ACTTGAGGATATAAGGGAATGGG + Intergenic
1165552571 19:36601155-36601177 ACACTTGTAATTAAGGAAATAGG - Intronic
1166047274 19:40236850-40236872 ATATTAAGAAATATGGAGATGGG - Intronic
1166729605 19:45051604-45051626 ACCTTCAGAAATAAGGGAATTGG - Intronic
1168181636 19:54665925-54665947 ACATTGGGTAAGTAGGAAATTGG + Exonic
924961591 2:39820-39842 ACATCTGAAAATAAGGGAATTGG + Exonic
925775141 2:7328076-7328098 ATAGTAGGAAATAAGGAGCTGGG + Intergenic
925932556 2:8721073-8721095 TCATAAGGAAAAAAGAAAATAGG - Intergenic
926257782 2:11223732-11223754 ACATTAGAAAAAAATGGAATGGG + Intronic
927144831 2:20156505-20156527 ACATTAGGAAATGACAAAACTGG + Intergenic
927526709 2:23749380-23749402 ACAATAGGAAATAAGAACAGAGG + Exonic
927814610 2:26203626-26203648 AGGTTAGGATGTAAGGAAATGGG - Intronic
928057971 2:28077676-28077698 AGGTTAGGAAATAAAGAGATAGG - Intronic
928117033 2:28552893-28552915 ACACAGGGAAATAAGGAAAATGG - Intronic
928444878 2:31324983-31325005 ACAGTTGAAAATAAAGAAATGGG + Intergenic
928641678 2:33305729-33305751 ACATTTAGAAGTGAGGAAATGGG + Intronic
928974158 2:37066286-37066308 CCATTAACAGATAAGGAAATTGG - Intronic
929193651 2:39163446-39163468 AAATTTGGGAAGAAGGAAATTGG + Intergenic
929502583 2:42502985-42503007 ACATTAAAAAAAAAGGAAAGGGG + Intronic
929630219 2:43452457-43452479 AGATTGGGAAATAAGATAATTGG - Intronic
929908670 2:46069866-46069888 AGCTTAGGAAATAAGGGAATAGG - Intronic
930277388 2:49329173-49329195 ACATTTAGAAAAATGGAAATAGG + Intergenic
930516277 2:52411696-52411718 ACATTAAAAAATAAGTAAAAGGG - Intergenic
930699106 2:54441280-54441302 AAATTGGGAGATAAAGAAATAGG + Intergenic
930782786 2:55239784-55239806 ACAAAAGCAAATAAGGAATTAGG - Intronic
931106872 2:59066461-59066483 AAATTAGGAAATGAGGAAAAAGG - Intergenic
932040848 2:68297734-68297756 ACATTAGGAAAATATGAAAATGG + Intronic
933077417 2:77946699-77946721 ACATTAGGTCCTATGGAAATTGG - Intergenic
933940598 2:87241808-87241830 AAACTTGGAAATAAGGAAAGAGG + Intergenic
933976252 2:87514498-87514520 TCAGTAGGAGAGAAGGAAATAGG - Intergenic
934874547 2:97904432-97904454 ACATTAACAAATGAGGAATTTGG + Intronic
935273328 2:101453861-101453883 ACATTAGAAAAAGAGGAAAATGG - Intronic
935623740 2:105151213-105151235 AAATTAGGCAATAAAGAAAAAGG + Intergenic
936317570 2:111436308-111436330 TCAGTAGGAGAGAAGGAAATAGG + Intergenic
936352538 2:111723968-111723990 AAACTTGGAAATAAGGAAAGAGG - Intergenic
936628302 2:114172745-114172767 AGATTATGATACAAGGAAATGGG + Intergenic
936704813 2:115059404-115059426 TCATTAGGAAATTAGGATATTGG - Intronic
938631643 2:133173916-133173938 ACATTTGGAAATCAGGAGAGGGG + Intronic
938733676 2:134166458-134166480 ACATAAGGAAACAATGGAATTGG - Intronic
939004691 2:136772345-136772367 TCATTTGGAAATATGGAAAAAGG + Intronic
939025965 2:137014153-137014175 TCACTAGGAAAACAGGAAATTGG - Intronic
939301121 2:140340529-140340551 AAATAAGGAAATAAGGAAGTAGG + Intronic
939769217 2:146293783-146293805 ACAAAAGGAAATAAAGAATTTGG + Intergenic
940065797 2:149627196-149627218 AAATTAGTAAAAAAGGCAATTGG + Intergenic
940078538 2:149772247-149772269 AAGTTAGAAAATAAGGAAATAGG + Intergenic
942203625 2:173596924-173596946 TCATTAGGTCATAAGTAAATAGG - Intergenic
942819083 2:180089740-180089762 ACATTAGGTAAGAAGGAATGGGG + Intergenic
942897606 2:181076366-181076388 TCAATAGAAAACAAGGAAATAGG + Intronic
943027359 2:182646154-182646176 ACATTAAGAATTAAGGAAAATGG + Intergenic
943035269 2:182737048-182737070 ACATTAGAAAATAAACAATTAGG - Intronic
943278741 2:185902302-185902324 TCCTTTGGAAATAAGGAAAATGG - Intergenic
943739351 2:191394513-191394535 ACTTTAGGAAGTCAGGAATTAGG - Intronic
943926492 2:193789631-193789653 AAATTAGAAAATAAGAAAATTGG - Intergenic
944208034 2:197177679-197177701 ACATAAAGAAATAAAGAAAAAGG + Intronic
944594216 2:201246569-201246591 ACATTTGGAAATCTGGAAGTTGG + Intronic
944817636 2:203394548-203394570 ACATTAGTAAAGACTGAAATTGG + Intronic
945295986 2:208171924-208171946 AAACTAGGAAATTAGGAAGTAGG - Intronic
945566343 2:211404972-211404994 AAATGTGGAAATTAGGAAATTGG + Intronic
945798255 2:214391540-214391562 ATAATAGTAAAGAAGGAAATGGG + Intronic
946303717 2:218843441-218843463 ACATTAGAAAAGAGGGAGATGGG + Intergenic
947235662 2:227938210-227938232 CCATTTGGAAATAAGGAGGTTGG + Intergenic
947697661 2:232205615-232205637 AAATTAGGAAATGAGGTAAAAGG + Intronic
948633796 2:239320503-239320525 AAATATGGAAATAAGGAAATTGG + Intronic
948711020 2:239825624-239825646 ACATTTGGACACAAGCAAATGGG + Intergenic
948882355 2:240866357-240866379 ATGTTGGGAAAAAAGGAAATGGG - Intergenic
1169052427 20:2592184-2592206 ACATAAAGAAAGAAGAAAATAGG + Intronic
1169239669 20:3965831-3965853 ACCTTAGAAAATAAGGGATTAGG + Intronic
1169956069 20:11104406-11104428 CCATTAAAAAAGAAGGAAATTGG + Intergenic
1170028978 20:11924269-11924291 AAATTGGAAAATAAGGAACTGGG + Exonic
1170504964 20:17015636-17015658 ACTTTAGGAAATACAGAATTTGG + Intergenic
1170714754 20:18821961-18821983 GCATTAAAAAATAAGTAAATAGG - Intronic
1171155271 20:22866342-22866364 ACATGAGGAACTAAGACAATGGG - Intergenic
1172682151 20:36724993-36725015 ACTTTAGAAAATATGAAAATCGG + Intronic
1172855049 20:37995237-37995259 ACAGGAAGAAAAAAGGAAATGGG + Intronic
1174291567 20:49512659-49512681 ACAATCTGAAATAAGGAAAATGG + Intronic
1174700273 20:52601120-52601142 AAATTGGGAAATAAAGATATGGG - Intergenic
1174943715 20:54961281-54961303 ACATTAAAAAATAAGAAAATGGG - Intergenic
1175315298 20:58043181-58043203 CCATGAGGAAATGAGAAAATAGG + Intergenic
1175560885 20:59929262-59929284 ACAGTGGGAATAAAGGAAATTGG + Intronic
1175686912 20:61037807-61037829 GTAAGAGGAAATAAGGAAATAGG + Intergenic
1176104295 20:63378541-63378563 GCATTAGGAAATAAGGAACGGGG + Intergenic
1176878215 21:14156820-14156842 ACAGGAGGAAATAAGGAACATGG + Intronic
1176906895 21:14511977-14511999 ACTTCAGGAAAAAAGGAAAGTGG + Intronic
1177877916 21:26657198-26657220 ACATTAGAAAAGATGGCAATTGG + Intergenic
1178147792 21:29759417-29759439 GCATTAGAAAATAAGGGAACTGG - Intronic
1178962190 21:37074822-37074844 AAATTAGACAATAAGAAAATTGG - Intronic
1181295006 22:21830740-21830762 ACAGAAGGAATGAAGGAAATTGG + Intronic
1181943883 22:26500105-26500127 ATTTTAGAAAATTAGGAAATAGG - Intronic
1184084656 22:42253133-42253155 TCATTAGGGAATAGGGAAATAGG - Intronic
1185107013 22:48877875-48877897 TCATTAGGCATTAAGGAAATAGG - Intergenic
949803108 3:7925050-7925072 CCATTATGAATGAAGGAAATTGG - Intergenic
950639106 3:14336560-14336582 AGAAGAGTAAATAAGGAAATTGG - Intergenic
951894331 3:27596490-27596512 ACAATAAGAAAAAAGGAAGTTGG - Intergenic
952032460 3:29160337-29160359 ACTTTAGGAAAAAAGAAAAAAGG - Intergenic
955814213 3:62825044-62825066 ATACTGGGAAATAAGAAAATTGG + Intronic
956586048 3:70866163-70866185 CCATAAAGAAATAAGAAAATAGG + Intergenic
957198499 3:77101735-77101757 ACATTAAAAAATAATAAAATTGG + Intronic
957381084 3:79430688-79430710 ACAAGAGGAAAAATGGAAATTGG - Intronic
957968407 3:87351779-87351801 ATATTAAGAAACAAGGAAACTGG - Intergenic
958057782 3:88435136-88435158 ACATTTAGAAAGTAGGAAATGGG - Intergenic
958470773 3:94515567-94515589 ACAATAAAAAATAAGAAAATTGG + Intergenic
958537252 3:95419040-95419062 ACTTTCAGAAAGAAGGAAATGGG - Intergenic
958572626 3:95907736-95907758 ACAATAGGAAGTAAAGAAAATGG - Intergenic
959857894 3:111181414-111181436 ACATTACAAAAAAAGGAAAAAGG - Intronic
960193839 3:114741058-114741080 ACCGTAGGAAATAGGGAAACAGG - Intronic
960641931 3:119833261-119833283 AGAGTAGAAAACAAGGAAATGGG + Intronic
962399503 3:135045738-135045760 ACATTGGGAAATAATGAATATGG - Intronic
962757180 3:138474181-138474203 ACATTAGGAAAAAAAAAAAAGGG - Intronic
962868384 3:139466800-139466822 ACACAAAGAACTAAGGAAATTGG - Intronic
963317261 3:143772866-143772888 ACTTTAGAAAACATGGAAATTGG + Intronic
963621873 3:147619919-147619941 TGATTAAGAAAAAAGGAAATAGG - Intergenic
963654235 3:148024911-148024933 CCATTAGGAGAAAAGGAGATTGG + Intergenic
963670993 3:148252150-148252172 AACTTAGGAAATAAGGCAAGAGG + Intergenic
963791825 3:149590816-149590838 CCATTAGGAAGGAAGGAAAAGGG + Intronic
963970446 3:151423556-151423578 ACATCTGGAAATAAAGACATGGG + Intronic
964186534 3:153952008-153952030 ACAGTAGAAAATAAAGCAATAGG - Intergenic
964430422 3:156599858-156599880 ACATTATGAAAAATGGAACTGGG + Intergenic
964795720 3:160494843-160494865 GGAAAAGGAAATAAGGAAATGGG + Intergenic
965516523 3:169627828-169627850 CAATTAGGAAATCAGGAAAGAGG + Intronic
965527643 3:169738571-169738593 AAAATAAAAAATAAGGAAATAGG + Intergenic
966504940 3:180689424-180689446 AGATAAGGAAATTATGAAATAGG - Intronic
966921076 3:184611797-184611819 ACACTAGGTCATAAGGAATTAGG - Intronic
967058970 3:185854614-185854636 ACATCAGAAAATAAGTTAATTGG + Intergenic
967657092 3:192063511-192063533 AAAAGAGGAAATAAGGAAAAAGG + Intergenic
967697514 3:192550129-192550151 ACATATAGAAAAAAGGAAATTGG + Intronic
967728296 3:192882463-192882485 ACACTTGGAAATAAGGCAAAAGG + Intronic
967779147 3:193417683-193417705 ACATTAGACAAAAAAGAAATTGG + Intronic
968835124 4:2958073-2958095 ACATTTGGAAAAGTGGAAATGGG + Intronic
969115968 4:4871089-4871111 ACACTAAGAAATAACGAATTCGG + Intergenic
969191991 4:5529334-5529356 AAATTAGGAGATGAAGAAATAGG + Intergenic
969226765 4:5803664-5803686 AGATTACTAAATAAGGAAAAAGG - Intronic
970199213 4:13585578-13585600 ACCATAGGAAAAAAGGCAATGGG + Intronic
970328106 4:14949495-14949517 TCATTAGGAGTTAAGGAAATAGG - Intergenic
970425580 4:15943000-15943022 TTATCAGAAAATAAGGAAATTGG + Intergenic
970766908 4:19560635-19560657 ACTTTAGAAAATATGAAAATGGG + Intergenic
970946499 4:21699159-21699181 ACTTTTGTAGATAAGGAAATGGG - Intronic
971130518 4:23804211-23804233 ACATTGGGAAAGAACCAAATGGG - Intronic
971192600 4:24441647-24441669 AAAAAAGGAAAGAAGGAAATAGG + Intergenic
971341558 4:25774146-25774168 ACAAAAGGAAATAAGGAGTTAGG + Intronic
971875881 4:32307900-32307922 AAATTAGGAAAGAATGAAAATGG + Intergenic
972423827 4:38914262-38914284 ACTTTAGAAAATAAGAAATTTGG + Intronic
973088731 4:46104043-46104065 ATATTAAAAAATAAGGAAACTGG + Intronic
973744371 4:53948786-53948808 ACGTTGGGAAAGAAGGAAGTTGG - Intronic
974017617 4:56663036-56663058 ACATTAGGCAATAAAGATAATGG + Intronic
974338480 4:60582889-60582911 ACAAAAAGAAATAATGAAATTGG - Intergenic
974553366 4:63410133-63410155 ACATTAGAAAAAAAGAAAATAGG + Intergenic
974753977 4:66179806-66179828 ATATTAAGAAATAAGTATATCGG + Intergenic
976005168 4:80421061-80421083 ATATGAGGAGATAAGGAAAGAGG - Intronic
976066868 4:81197801-81197823 ACAACATGAAATAAGGAAAAGGG + Intronic
976369350 4:84268989-84269011 ACCTTAGGAAGAAAGGAAAGAGG + Intergenic
977475890 4:97508999-97509021 ACAATAGGAAAATAGGAAAATGG - Intronic
977821273 4:101474978-101475000 ATATTTGTAAACAAGGAAATTGG + Intronic
978428719 4:108609575-108609597 ACATTAGTAAATATAGAAGTGGG + Intergenic
978704147 4:111684979-111685001 ACAATATGAAAAAAGAAAATGGG + Intergenic
978885690 4:113763307-113763329 AGATCAGGAAAAAAGGAATTAGG - Intergenic
978990620 4:115077656-115077678 AAATTAGGAAATCAGGAATCAGG + Intronic
979034773 4:115701259-115701281 ACATGAAGAAATAGGAAAATGGG + Intergenic
979433236 4:120657802-120657824 AAATAAGTAAATAAGGAAACAGG + Intergenic
979613370 4:122713562-122713584 ACATTTGGAATTAAGGCAATAGG + Intergenic
980323078 4:131304213-131304235 AAATTATGAAATACAGAAATTGG + Intergenic
980484401 4:133436755-133436777 GAATTAGAAAATAAGGAAATGGG - Intergenic
980701336 4:136435372-136435394 AGATTAGAAACTAAGGAAATTGG - Intergenic
980854326 4:138421308-138421330 ACCTTACAAAATAAGGAAGTGGG + Intergenic
980892689 4:138831945-138831967 CCTTTAAGAAATAAGAAAATTGG - Intergenic
980966542 4:139526660-139526682 ACATTTGGTAATGAGGAAACAGG + Intronic
981583902 4:146279114-146279136 ACTTTTGGAAATAAGAAATTTGG + Intronic
981686585 4:147461398-147461420 ACATTAGGAAATGCTGATATGGG - Intergenic
981705215 4:147652178-147652200 AAATTAGAAAGTAAAGAAATTGG - Intronic
981804883 4:148703391-148703413 ACATAAAGAAACAAGTAAATGGG - Intergenic
981880159 4:149600909-149600931 ACATTCTCAAATAATGAAATAGG - Intergenic
982191199 4:152857186-152857208 ATATTAGGAAATGAGTGAATGGG + Intronic
982429620 4:155307871-155307893 TCAAGGGGAAATAAGGAAATGGG - Intergenic
982523829 4:156452962-156452984 AAATAAGGAAATAAAGAAAGAGG - Intergenic
982898315 4:160963255-160963277 TCATTAAAAGATAAGGAAATGGG + Intergenic
982990991 4:162273634-162273656 ACAGGAGGAAATAATGAAAAAGG + Intergenic
983494424 4:168427175-168427197 ACATTCTGGAATAAGGAAATTGG - Exonic
983675112 4:170283022-170283044 ACATTTAGAAATAAAGAACTCGG + Intergenic
984410205 4:179388286-179388308 ATATTAAGAAATAAGGAGAAAGG + Intergenic
984923293 4:184784698-184784720 ACATGAGGACCTAAGGAAGTAGG + Intronic
985295634 4:188434510-188434532 GCATTAGAAAAAAAAGAAATGGG + Intergenic
985313894 4:188633480-188633502 CAATTAAGAAATAAGGAAAATGG + Intergenic
986111808 5:4726523-4726545 TGATTCGGAAATAAGGAAAACGG + Intergenic
986277102 5:6286183-6286205 AAATAAGGAAGGAAGGAAATAGG + Intergenic
986516334 5:8567783-8567805 CCATAAGGAAATAATGAAAATGG - Intergenic
986547667 5:8916555-8916577 GCCTTAACAAATAAGGAAATAGG - Intergenic
986562447 5:9075693-9075715 GCAAAAGGAAATGAGGAAATGGG + Intronic
986665962 5:10104417-10104439 GGAATAGGAAAAAAGGAAATAGG - Intergenic
986770362 5:10967173-10967195 ACACTAGGTAATAAAGAAAGTGG + Intergenic
986894734 5:12351625-12351647 AAATTAGGAACTCAAGAAATAGG - Intergenic
987082503 5:14438318-14438340 ACATTAGCAAGTAAGTAAAGGGG - Intronic
987385935 5:17329392-17329414 GCATTAGGAAAGAAGAAAAAAGG - Intergenic
987587898 5:19881174-19881196 ACATTTGGAAACAAGGAAAAGGG + Intronic
987604638 5:20116632-20116654 ATATTAGAAAAGAAGTAAATTGG - Intronic
988030553 5:25757992-25758014 ACATTAGCAAATAAAGTAAATGG + Intergenic
988252337 5:28775766-28775788 ATATTAGGAATAAAGGAAAATGG + Intergenic
988360190 5:30227490-30227512 ACTTGTTGAAATAAGGAAATAGG + Intergenic
988464557 5:31476062-31476084 AGATTAAGAAATAAGGCCATTGG + Intronic
988873399 5:35416066-35416088 ATATTAGGAAGTGGGGAAATTGG + Intergenic
989630480 5:43477202-43477224 ACAACAACAAATAAGGAAATTGG + Intronic
989781750 5:45274582-45274604 AAATTAGAATACAAGGAAATGGG - Intronic
990226337 5:53659267-53659289 ACAGCAGAAAATAAGGAAAAAGG - Intronic
990390267 5:55311980-55312002 ACATTATGATGTAATGAAATAGG - Intronic
991195962 5:63932568-63932590 TCATTGGGAAGGAAGGAAATGGG - Intergenic
992407451 5:76473144-76473166 ACATTAAGAAATAAAGAAATGGG - Intronic
992424583 5:76643597-76643619 ACATCAGAAAAAAATGAAATAGG + Intronic
992733106 5:79691577-79691599 ACATGAGGGAATATGGAAAATGG + Intronic
993248386 5:85482635-85482657 TCACTAGGAAATATTGAAATAGG + Intergenic
993537452 5:89104234-89104256 ATATGATGAAATTAGGAAATAGG + Intergenic
993726212 5:91369396-91369418 ATACTAGATAATAAGGAAATGGG - Exonic
994752922 5:103761237-103761259 ACTTCAGGAAATAAGAAAAGTGG - Intergenic
994831698 5:104792051-104792073 ACAAAATGAACTAAGGAAATGGG - Intergenic
994944367 5:106366744-106366766 CCATTAGGAAATAAGAGAACAGG + Intergenic
995042878 5:107609125-107609147 AAATTAAGTAAGAAGGAAATAGG + Intronic
995319439 5:110815870-110815892 ACATAAGGAAATAAACAAGTGGG + Intergenic
997204479 5:132036485-132036507 ACATTAGAAAATAACTTAATGGG + Intergenic
997574483 5:134963699-134963721 ACTTTAGCAAAGAAGGAAACAGG - Intronic
998483243 5:142480213-142480235 ACAAGAGGAAGTAAGGAAAAGGG + Intergenic
998547072 5:143038496-143038518 TCTTGAGGAAATAAGGATATGGG + Intronic
998575797 5:143314752-143314774 ACATTAGGAATTAGAGACATGGG - Intronic
998945657 5:147336963-147336985 AAAATAGCAAACAAGGAAATCGG - Intronic
999800017 5:155024809-155024831 ACTTTAGGAAATAATGGCATGGG + Intergenic
1000938227 5:167328768-167328790 ACATAAGGAAATAAGTGACTAGG - Intronic
1001133597 5:169084248-169084270 ACATTCCAAAATAGGGAAATAGG + Intronic
1001420461 5:171582465-171582487 ACAATATGAAAGAAGAAAATGGG - Intergenic
1001657124 5:173360158-173360180 ACATTAGGATAAAAGTAAGTTGG + Intergenic
1002692822 5:181062321-181062343 ACACCAGAAAATAAGGAAGTAGG + Intergenic
1003467446 6:6394347-6394369 GCATTAGGAAATCAGGAGAATGG - Intergenic
1004247512 6:13994085-13994107 AACTCAGGAAATAAGGAAAAAGG - Intergenic
1006173478 6:32108585-32108607 TCTTTAGGAAATACTGAAATGGG - Intronic
1007192058 6:40027790-40027812 CCATTTTAAAATAAGGAAATAGG - Intergenic
1007666441 6:43516365-43516387 GGCTTAGGAAAGAAGGAAATGGG - Intronic
1007913455 6:45538541-45538563 AAATTAGGAGAGAAGGAACTAGG - Intronic
1008722552 6:54374160-54374182 ACATCAGGATATAAGGAATATGG + Intronic
1010087816 6:71941081-71941103 ACATCATGATATAAGGAAAAAGG - Intronic
1010499787 6:76583277-76583299 AAATTAGGAAATATGCAAAATGG - Intergenic
1010816727 6:80366610-80366632 ACACTATGAAATGAGAAAATGGG - Intergenic
1010903740 6:81459720-81459742 ACATTATGAAATAAAGCAATTGG - Intergenic
1011036471 6:82981977-82981999 AGATGAGGTAATAAGCAAATAGG + Intronic
1011089476 6:83580114-83580136 TCATTTGGAAATAAGAACATAGG - Intronic
1011441063 6:87387871-87387893 ACAAAAGGAAAAAGGGAAATGGG + Intronic
1011506786 6:88053719-88053741 AAATTAGGAAATAACCTAATAGG - Intronic
1011692206 6:89880555-89880577 ACATTAAGAAAGAAAAAAATGGG - Intergenic
1011707903 6:90021772-90021794 CCATTAGAAAATACTGAAATTGG - Intronic
1011731814 6:90272792-90272814 ACATTAGGAAAGAAGAGAAGAGG - Intronic
1011732233 6:90276713-90276735 TTACTAGGAAATAAGAAAATGGG - Intronic
1011920446 6:92569084-92569106 GCATTAGAAAAGAAGAAAATTGG + Intergenic
1011980357 6:93367920-93367942 ACATTTGGGAATAGGGAAAGTGG - Intronic
1012009594 6:93766056-93766078 ACATCAGTAAAGATGGAAATTGG + Intergenic
1012158520 6:95852633-95852655 ACATTTTGATATAAGGAAGTTGG + Intergenic
1012652768 6:101777569-101777591 AAATGAGGAAACAAGGCAATAGG + Intronic
1013875993 6:114829430-114829452 TCATCAGGAACTAAGGAAAATGG - Intergenic
1014125609 6:117773577-117773599 ACTTTATCAAATAAAGAAATAGG - Intergenic
1014305892 6:119741886-119741908 AAAGTAGGAAAAGAGGAAATTGG - Intergenic
1015035350 6:128646667-128646689 CCACTATGAAATAAGGGAATTGG - Intergenic
1015121021 6:129701800-129701822 AAATTAGGAAATAAAGAGATGGG + Intronic
1015126507 6:129761010-129761032 AAATTGGAAAATAGGGAAATTGG + Intergenic
1015304514 6:131692155-131692177 AAATGAGAAAATGAGGAAATAGG + Intronic
1015413303 6:132919471-132919493 ACACTTGGAAATTAGGAAACTGG + Intergenic
1016087670 6:139934346-139934368 GCATTAGTAACAAAGGAAATAGG + Intergenic
1016100982 6:140099917-140099939 ACATTAGCAAAGAAGAAATTTGG - Intergenic
1016278990 6:142391332-142391354 ACATTCTGAAATAAGAAAAATGG + Intronic
1017510886 6:155113375-155113397 AAAATAGTAAAGAAGGAAATGGG - Intronic
1018513503 6:164552457-164552479 AAATAAGTAAATAAAGAAATAGG + Intergenic
1020268375 7:6577083-6577105 ACATAAGTAAATAAGAAAATAGG + Intergenic
1020376662 7:7495109-7495131 ACATTAAGAAATAAAAAAACAGG + Intronic
1021338826 7:19438256-19438278 GCATTATGCAATAAGGAAGTAGG + Intergenic
1021883999 7:25120776-25120798 ACCTTCAGAAATAAGGAAATAGG - Exonic
1022879458 7:34570729-34570751 ACATTAGGTAAACACGAAATTGG - Intergenic
1022931544 7:35121472-35121494 ATATTAGTAAAGAAGGAAAAAGG + Intergenic
1023171781 7:37396774-37396796 ACACTTGGAAATAGGCAAATAGG - Intronic
1023475425 7:40572816-40572838 TGATTTGGAAATAAGGAGATAGG - Intronic
1024421159 7:49168332-49168354 AATTTATGAAATAAGGAAAGAGG + Intergenic
1026777718 7:73241193-73241215 ATTTTTGGAAACAAGGAAATGGG - Intergenic
1027018572 7:74794585-74794607 ATTTTTGGAAACAAGGAAATCGG - Intergenic
1027069456 7:75151352-75151374 ATTTTTGGAAACAAGGAAATCGG + Intergenic
1028712372 7:93923883-93923905 ACCTTAGGAAATACAGAAAGAGG + Intronic
1029912352 7:104166994-104167016 ACTTTTTAAAATAAGGAAATAGG - Intronic
1029963387 7:104712013-104712035 ACATTAGGATACATGGAAAGGGG + Intronic
1031120393 7:117715314-117715336 ATATTTGGAAAGAAAGAAATGGG + Intronic
1031295229 7:119993635-119993657 AAATAAGCAAATAAGGAAATGGG - Intergenic
1031321306 7:120332320-120332342 ACATTTGGAAATACTGCAATAGG - Intronic
1032330999 7:130979365-130979387 ACAACAGGAAATCAGGAAACAGG + Intergenic
1033299481 7:140174435-140174457 ACACTTGTAAATAGGGAAATAGG - Intronic
1033653789 7:143360788-143360810 AAAATAGGAATTAAGAAAATAGG + Intronic
1035898651 8:3433706-3433728 AGATTAGAAAATAAGAATATGGG - Intronic
1035954648 8:4062963-4062985 AGATAAAGGAATAAGGAAATAGG + Intronic
1036905741 8:12707236-12707258 ATATTAGGAAATATGAAACTGGG - Intergenic
1036932669 8:12971651-12971673 AAATTAGCAAACAAGAAAATGGG + Intronic
1037221680 8:16530167-16530189 GCATTAAAAAATAAGAAAATGGG - Intronic
1037440583 8:18912162-18912184 ACATTATGAAATAAGGATCTGGG - Intronic
1038114644 8:24539659-24539681 ACATTAAAAAATGAGGAGATTGG - Intergenic
1038608804 8:29039547-29039569 ACATTAGGGAATAAATGAATGGG - Intronic
1038869198 8:31475415-31475437 ACACTTCAAAATAAGGAAATGGG - Intergenic
1039113340 8:34064307-34064329 TCATTAGGGAATAAGACAATAGG - Intergenic
1041283445 8:56235366-56235388 AGATGAGGAAAAAAGCAAATTGG - Intergenic
1041543391 8:59012212-59012234 ATATTTGGAGATAAGGCAATTGG + Intronic
1041584634 8:59501118-59501140 ACATTAAGAAAGAACCAAATAGG + Intergenic
1042003862 8:64158730-64158752 ACTTTTGGCAACAAGGAAATGGG - Intergenic
1042557767 8:70047989-70048011 ACATTATACAATGAGGAAATGGG + Intergenic
1042679443 8:71366038-71366060 TCTTTAGGAAGTCAGGAAATAGG - Intergenic
1043196819 8:77304168-77304190 AAATGAGAAAATAAAGAAATAGG - Intergenic
1043230819 8:77798676-77798698 AAACTAGAAATTAAGGAAATTGG - Intergenic
1043471761 8:80569977-80569999 TCATGAGGAAGTAAGTAAATAGG + Intergenic
1044024489 8:87151628-87151650 ACATGGGGAAATAACCAAATTGG + Intronic
1045427201 8:102078769-102078791 AAATAAGGTAATAAGGTAATTGG - Intronic
1045600163 8:103705973-103705995 ACAGTAGGAAAGAAGGAAGAAGG - Intronic
1046009244 8:108526450-108526472 ACAGTAGAAAATTTGGAAATTGG + Intergenic
1046227212 8:111298167-111298189 ACATGAGGATATATGAAAATCGG + Intergenic
1046451012 8:114389340-114389362 ACATAAGTAAATATGTAAATAGG - Intergenic
1046590253 8:116197810-116197832 AAATTAAGAAATAAAGAAAGAGG - Intergenic
1047133361 8:122047971-122047993 AAATTAAAAAATAAAGAAATTGG - Intergenic
1047176064 8:122541585-122541607 ACATAAGGAAGTAAGAAAGTGGG + Intergenic
1048187637 8:132256916-132256938 ACATAAGGAAATAATGACATCGG + Intronic
1048935110 8:139348671-139348693 TCATCAGGAAATAAGGAATTTGG + Intergenic
1049996453 9:1039422-1039444 ACATTTGGAATTCAGGAACTGGG + Intergenic
1050268926 9:3920693-3920715 ACATAAGCAAATATAGAAATCGG - Intronic
1050435443 9:5605170-5605192 ACATTAGGAAATAAAAAATATGG + Intergenic
1050620381 9:7446132-7446154 ACATGATGAAATAAAGAAACAGG - Intergenic
1051031087 9:12679596-12679618 ACATTGTGAACTAAGGAAGTTGG + Intergenic
1051351188 9:16199338-16199360 ACATTAGGAAAAAAAAAAATTGG - Intergenic
1051381439 9:16463009-16463031 ATGTGAGGAAAGAAGGAAATGGG - Intronic
1051507144 9:17839743-17839765 GCTTTAAGAAATAAAGAAATTGG - Intergenic
1052009212 9:23386074-23386096 ACATTTGAAAATAAGTAAAAGGG + Intergenic
1052468486 9:28861874-28861896 AAATTAGGATACAAGGATATAGG + Intergenic
1052655134 9:31349347-31349369 AAATTGGGAAATAAATAAATTGG - Intergenic
1054924450 9:70575352-70575374 ACAGTAGGAAAAAATGAAGTAGG - Intronic
1055218783 9:73901895-73901917 GCATTATGAAATAAGGATGTTGG + Intergenic
1055634774 9:78265698-78265720 ACAATACAATATAAGGAAATGGG - Intronic
1056317566 9:85405942-85405964 ACATTTGGAAACAAGGAACCTGG + Intergenic
1058176642 9:101742931-101742953 ACCTTAGAAACTAAGGAAATAGG + Intergenic
1058811249 9:108641710-108641732 ACATCAGGATGTCAGGAAATAGG - Intergenic
1059796317 9:117701059-117701081 AGATGAGGAACTAAGGAAAAGGG - Intergenic
1059798344 9:117724448-117724470 ACATCAAAAAATAAGGAAGTTGG - Intergenic
1059914851 9:119087343-119087365 ACATTAGGAATTAAGGAGATAGG - Intergenic
1060076254 9:120593025-120593047 AAATTTGGAAACAAGGAATTTGG - Intergenic
1060121698 9:120997428-120997450 ACATTAAGCATTAAGGAAACTGG - Intronic
1061643348 9:131977741-131977763 TAATTAGAAAATAAGTAAATTGG + Intronic
1061720709 9:132549413-132549435 ACATGCGGAAATAGGGCAATGGG + Intronic
1185657779 X:1699776-1699798 ACATTGGCATGTAAGGAAATTGG - Intergenic
1186543786 X:10427630-10427652 ACATTAGAAAAACAGGCAATGGG + Intergenic
1186701224 X:12092375-12092397 ACATCAGGAAATAAGGTCAATGG + Intergenic
1186898129 X:14025669-14025691 CCATGACTAAATAAGGAAATTGG + Intronic
1187088090 X:16063008-16063030 AATTTAGGAAGCAAGGAAATTGG - Intergenic
1187125701 X:16452372-16452394 ACGTTAAGAAATAAAAAAATTGG - Intergenic
1187510758 X:19916355-19916377 ACATAAAGAAATAAGGTATTGGG + Exonic
1187647342 X:21362885-21362907 ACATTAGGAAGAAAGAACATAGG - Intergenic
1188021360 X:25162198-25162220 AAATTCAGAAATAAGGAGATTGG - Intergenic
1189142741 X:38623849-38623871 AATTTAGGAAATAAAGAAGTGGG - Intronic
1193180943 X:78456001-78456023 ACATAAGGAACTAAGGAATGGGG + Intergenic
1193422692 X:81302666-81302688 ACATAAGTAAATAAATAAATCGG - Intergenic
1193803411 X:85965057-85965079 AGATTAGTAAATAAGGAAGGTGG - Intronic
1194046265 X:89007723-89007745 ATTTTAGGGAATAATGAAATAGG + Intergenic
1194641813 X:96411886-96411908 ACATTAGCAAATTTGGTAATTGG - Intergenic
1194850976 X:98868656-98868678 TTATTAGAACATAAGGAAATAGG - Intergenic
1194984499 X:100475928-100475950 ACATTTGGGAATAAAGAACTAGG - Intergenic
1195785608 X:108518247-108518269 CCATTTGGAAATAGTGAAATGGG - Intronic
1196175138 X:112631763-112631785 ACAGAAGGAAAGAAGAAAATAGG - Intronic
1196328035 X:114432134-114432156 ATACTAGGAAATAAGGCAAAAGG - Intergenic
1197688812 X:129475216-129475238 ACATTATGAATTAAGCAGATAGG + Intronic
1197999976 X:132423658-132423680 TCATTAGGAAAAAAGGAGAAAGG - Intronic
1198855743 X:141014060-141014082 ACAGGAGCAAATAAAGAAATAGG + Intergenic
1198876386 X:141232079-141232101 ACAGGAGCAAATAAAGAAATAGG - Intergenic
1198906950 X:141573308-141573330 ACAGGAGCAAATAAAGAAATAGG - Intergenic
1198909846 X:141601151-141601173 ACAGGAGCAAATAAAGAAATAGG + Intronic
1198917240 X:141686988-141687010 ACAGGAGCAAATAAAGAAATAGG - Intronic
1199412965 X:147546429-147546451 CCATTCAGAAATAAAGAAATTGG + Intergenic
1201402092 Y:13614264-13614286 ACATTCAGAATTATGGAAATTGG - Intergenic