ID: 924500683

View in Genome Browser
Species Human (GRCh38)
Location 1:244635622-244635644
Sequence GCTGCTTCTGGGAGACACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924500683_924500690 -2 Left 924500683 1:244635622-244635644 CCCCCGTGTCTCCCAGAAGCAGC 0: 1
1: 0
2: 2
3: 26
4: 213
Right 924500690 1:244635643-244635665 GCCTGTGCACTCACTTTTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 161
924500683_924500689 -3 Left 924500683 1:244635622-244635644 CCCCCGTGTCTCCCAGAAGCAGC 0: 1
1: 0
2: 2
3: 26
4: 213
Right 924500689 1:244635642-244635664 AGCCTGTGCACTCACTTTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924500683 Original CRISPR GCTGCTTCTGGGAGACACGG GGG (reversed) Intronic
900114047 1:1020995-1021017 GGTGCTTCTGGGAGCCCCCGGGG + Intronic
900482547 1:2906181-2906203 GCTGCTTCAGGGAGCGAGGGTGG + Intergenic
900683317 1:3931056-3931078 GTTCCTTCTGGGAGGAACGGAGG + Intergenic
900831967 1:4971892-4971914 GCTGCCCCAGGGAGGCACGGAGG - Intergenic
907498365 1:54860452-54860474 CCTGCCACTGGGATACACGGAGG + Intronic
911925790 1:103830777-103830799 GCTGCTTGTGGGAGCCAGGGTGG - Intergenic
912042051 1:105403013-105403035 GCTCCTACTGCGAGTCACGGTGG - Intergenic
914705042 1:150163297-150163319 GCTCCTGTTGGGAGACAGGGAGG - Intronic
915298000 1:154935317-154935339 GCTGCTTTTGGGTACCACGGGGG - Intronic
917359253 1:174158935-174158957 GTTCCTTCTGTGAGACTCGGGGG - Intergenic
917531480 1:175839906-175839928 GAAGTTTATGGGAGACACGGAGG + Intergenic
920327268 1:205175377-205175399 GCAGCTTCTGGCGGGCACGGTGG - Intronic
920802166 1:209199555-209199577 GCTGCTTCTCGGAGGCTAGGTGG - Intergenic
923582038 1:235226954-235226976 ACTGCTCCTGGCAGGCACGGTGG - Intronic
924500683 1:244635622-244635644 GCTGCTTCTGGGAGACACGGGGG - Intronic
1062982634 10:1737732-1737754 GGTGCGTCTGGGAGAGACCGGGG + Intergenic
1063552339 10:7044883-7044905 GCTCCTTCTGGGTGACAGAGGGG + Intergenic
1063975034 10:11408262-11408284 GCTGCTTCTTGGAGCCAGGCTGG + Intergenic
1064118938 10:12602852-12602874 GATGCTTATGGGAGTCACTGTGG - Intronic
1064731373 10:18334367-18334389 GCTGCTTTTGAGACCCACGGGGG + Intronic
1069015735 10:63427228-63427250 CCGCCTTCTGGGAGACACGCGGG - Intronic
1069097047 10:64271659-64271681 GCTGCTTCTGGGAGGAGCGAAGG - Intergenic
1071872331 10:89808972-89808994 GCTGCTTCTGGGAGACAAAGTGG + Intergenic
1072741372 10:97911990-97912012 GCTGGTTGTGGGAGACACCACGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073427676 10:103465693-103465715 CCTGCTTCTGGGAAATACTGTGG + Intergenic
1074392626 10:113070911-113070933 GTGGCTACTAGGAGACACGGGGG - Intronic
1074848594 10:117420752-117420774 TCTGCTCCTGGGAGCCATGGAGG - Intergenic
1075746527 10:124731996-124732018 GCTGATCCTGGCAGACATGGAGG - Intronic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076679052 10:132162123-132162145 TCTGCTTCTGGGAGACACTGGGG + Intronic
1076995569 11:295997-296019 GCTGCTTCTGGCAGCCGCTGAGG - Exonic
1077490589 11:2859180-2859202 GCTGCACCTGGGAGCCACGTGGG + Intergenic
1077632485 11:3820228-3820250 TCTGCTTATGGGAGAGACGCAGG - Intronic
1077824810 11:5794751-5794773 GCTGTTTCAGCCAGACACGGTGG - Intronic
1077888221 11:6401706-6401728 GATGGTACTGGGAGACACTGAGG - Intronic
1078063033 11:8060583-8060605 GATGCTTCTGGGTGACCCTGGGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078854705 11:15197602-15197624 GCTGCTTCTGGGAGAAAATGTGG + Intronic
1079016880 11:16876424-16876446 GCTGCTTCTGGGAGGAAGAGCGG - Intronic
1083880486 11:65546023-65546045 GCTGCTTCCTGGAGACACAGCGG - Intronic
1084145798 11:67264757-67264779 GCTGCTTCTGGGTGCCAAGCAGG + Intergenic
1084603504 11:70160064-70160086 GCTGCAACTGGGAGACACACAGG + Intronic
1084945465 11:72636004-72636026 GCTGCCACTGGGAGACAGGAAGG - Intronic
1085084179 11:73655816-73655838 GCGGCTCCTGGGAGGGACGGTGG - Exonic
1085299052 11:75447923-75447945 GCTGCCTCTGGGAGGGACTGGGG + Intronic
1086555432 11:88104923-88104945 GCTGCTTCTGGGAGACTCCATGG + Intergenic
1087370580 11:97279190-97279212 GCTGCTGCTGAGGGACATGGGGG - Intergenic
1087482818 11:98722537-98722559 ACTGCTTCTTGGAGACAAGTCGG + Intergenic
1087630378 11:100643495-100643517 CCTTCTTCTGGGAGCCACTGTGG + Intergenic
1088640301 11:111866458-111866480 GTTGTTTCTGAGAGACAGGGTGG - Intronic
1091222517 11:133937605-133937627 GATGCATCTGGGGGACACGAAGG + Intronic
1091626031 12:2121726-2121748 CCTGCTTCAGGGAGACACTTTGG - Intronic
1100366733 12:93928396-93928418 GCTGCTTCAGTGAGACATGGCGG - Intergenic
1100438564 12:94594378-94594400 CCTGGTTCTGCCAGACACGGTGG - Intronic
1101552043 12:105772304-105772326 GCTGGTTCTGTCAGGCACGGTGG + Intergenic
1101900387 12:108787714-108787736 GGTTCTTCTTGAAGACACGGTGG + Exonic
1102599429 12:114017913-114017935 TCTGCTTCTGGGAGAACTGGAGG + Intergenic
1102849149 12:116222585-116222607 GCATCTTCTGGGAAACATGGCGG + Intronic
1104637115 12:130444793-130444815 GGTGCCTCTGGGAGACCCTGAGG + Intronic
1107302486 13:38980209-38980231 GCGGCTTCTGGGAGAATTGGTGG + Intronic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1113535200 13:111060991-111061013 GCTGTGTCTGGGAGACAGGACGG + Intergenic
1114672402 14:24418264-24418286 GCTGCTTCTGTTAGACCCAGGGG + Exonic
1115114544 14:29863921-29863943 GCTACTTCTGGGAAACAATGTGG + Intronic
1118472400 14:66086904-66086926 TCTGCTTCTTGGATACATGGTGG - Intergenic
1121562884 14:94887595-94887617 GCCGCCTCTTGGAGACAGGGAGG - Intergenic
1122352426 14:101103789-101103811 GCTGCCTCTGGGGGAGGCGGAGG - Intergenic
1123154344 14:106209979-106210001 GCCACTGCTGGGAGTCACGGGGG + Intergenic
1124631282 15:31338991-31339013 GCTCATCCTGGGAGACACTGTGG + Intronic
1125598020 15:40899826-40899848 GCTGCTACTGGCAGACCGGGTGG + Exonic
1127543913 15:59971692-59971714 ACTGCTTCTGTGAGACTGGGAGG - Intergenic
1130872887 15:87985243-87985265 GCTACTGCTGGGAGAGAAGGTGG + Intronic
1131308572 15:91267410-91267432 GCTGCCTCTAGGAGACAGTGGGG + Intronic
1131398737 15:92107783-92107805 CCTGCTTCTAGGAGAGAAGGGGG + Intronic
1131582506 15:93658589-93658611 GCTGCTTCTGGGCGTCATGGTGG + Intergenic
1132778608 16:1610876-1610898 GCTTTTTCTAGGAGAGACGGCGG + Intronic
1132904590 16:2276054-2276076 GCTGCTTCTAGGAGATGCTGTGG + Exonic
1133204473 16:4224948-4224970 GCTGAACCTGGAAGACACGGTGG + Intronic
1133769065 16:8857181-8857203 TATGCTTGTGGGAGACAGGGTGG - Intronic
1134757402 16:16680100-16680122 GCTGTTTCTGGGATACAAGGGGG + Intergenic
1134988666 16:18679066-18679088 GCTGTTTCTGGGATACAAGGGGG - Intergenic
1136483608 16:30557574-30557596 GCTGCATCTGGGAGCCACGCAGG + Intronic
1136716562 16:32287505-32287527 GCTGCTTCTGGGTGAACCTGGGG + Intergenic
1136834950 16:33493783-33493805 GCTGCTTCTGGGTGAACCTGGGG + Intergenic
1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG + Intergenic
1140229242 16:73103868-73103890 GCTTGTTCTGGCAGATACGGTGG + Intergenic
1141075758 16:81005655-81005677 GCTGCTTCTGGGAGGGACCCGGG + Intronic
1141715191 16:85722921-85722943 GCTCATCCTGGAAGACACGGAGG + Intronic
1142167749 16:88601879-88601901 GCTGTTTCTGATAGACACAGTGG + Intronic
1142280020 16:89143143-89143165 GCTGATGCTGGGAGAAACTGGGG - Intronic
1142361839 16:89631074-89631096 GCTGCTTTTGGGAGAAGCTGAGG - Intronic
1203009853 16_KI270728v1_random:230249-230271 GCTGCTTCTGGGTGAACCTGGGG - Intergenic
1203145112 16_KI270728v1_random:1794071-1794093 GCTGCTTCTGGGTGAACCTGGGG + Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1147132014 17:38415221-38415243 GCTGCTCATGGGAGAGACTGGGG + Intergenic
1147744764 17:42688359-42688381 GCTGCTACTGGGACACAGTGGGG + Intronic
1148736545 17:49868387-49868409 GCTTTTTCTGGGAGACAGAGAGG + Intergenic
1149319871 17:55471847-55471869 GCTGCCTCAGGCAGACACAGAGG - Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150245897 17:63674828-63674850 TCTGCCTCTGAGAGACATGGAGG + Intronic
1151786716 17:76278783-76278805 CCTGCTTTTGGGAGTTACGGTGG - Intronic
1152442865 17:80319778-80319800 ACTGTTCCTGGGAGACAGGGGGG - Intronic
1153443904 18:5151156-5151178 GCTGCTGCTGGTAAACAGGGAGG + Intronic
1154138348 18:11800691-11800713 GCGGCCTCTGGGAGACTCGTGGG + Intronic
1154289561 18:13095510-13095532 GGAGCTTCTGGGAAACATGGTGG + Exonic
1156312311 18:35935921-35935943 GCTGATGCTGGGATGCACGGGGG - Intergenic
1158111743 18:53947623-53947645 GCTGATTCTGGGAAACAAAGAGG - Intergenic
1159137364 18:64351993-64352015 TCTCCTTCTGTCAGACACGGTGG - Intergenic
1159334427 18:67044420-67044442 GCTGGCACTGGGAAACACGGTGG - Intergenic
1161411185 19:4118424-4118446 GCTGCATCAGGTAGGCACGGTGG + Intronic
1162018295 19:7857258-7857280 ACCGCTTCTGGGGGACACAGAGG + Intronic
1162797574 19:13094813-13094835 GCTGCTTCTGGGGCCCGCGGGGG - Exonic
1165215092 19:34265360-34265382 GCTGCTCCTGGGTGTCAAGGTGG + Intronic
1165420753 19:35720879-35720901 GGTGCTTTTGGGGGCCACGGTGG - Exonic
1165758031 19:38305300-38305322 GCTGCTGCTGGGGGCCACTGTGG - Exonic
1166084533 19:40466138-40466160 GCTGGTTCTGGGAGGCCCTGGGG - Intergenic
1166339619 19:42129713-42129735 GCTGCTTCTGGGGAGGACGGGGG - Intronic
1167432394 19:49461958-49461980 GCTGCTGCTGACGGACACGGCGG + Exonic
926087387 2:10028869-10028891 GCTGGTCCTGGGAGACGCTGAGG - Intergenic
926684954 2:15691227-15691249 GCTGCTGCAGGGAGACCCGGCGG + Intronic
926939524 2:18120075-18120097 GCTGTTGCCAGGAGACACGGAGG + Intronic
927853700 2:26515104-26515126 CCTGCTGCTGGGAGAGCCGGAGG - Intronic
930090521 2:47528311-47528333 GCTCATCCTGGGAGACAAGGTGG + Intronic
934737602 2:96697863-96697885 GCTGTCTCTGGGAGACAGTGCGG - Intergenic
935595667 2:104875409-104875431 GCTGCTTCTGGGGGAAACTATGG - Intergenic
936344283 2:111663304-111663326 GCTGGTTCTGGGAGAGTCTGTGG - Intergenic
944891606 2:204123068-204123090 GTTGTTTCTGGGAGTTACGGAGG - Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1172167185 20:32906638-32906660 GCAGCTTCTGGGTGACATGAAGG - Intronic
1172969745 20:38864811-38864833 GGTGTTTCTGGGTGACACTGTGG + Intronic
1175287053 20:57844082-57844104 GCTTATGCTGTGAGACACGGAGG + Intergenic
1176028653 20:62999517-62999539 GCTGCTGGTGGAAGAAACGGAGG - Intergenic
1176197478 20:63844158-63844180 GCTGCTTCTGGGAACCCTGGGGG + Intergenic
1178409991 21:32355547-32355569 GCAGATTCTGCGGGACACGGGGG - Exonic
1178811162 21:35882780-35882802 GCGGCATCTGGGAGCCAGGGTGG - Intronic
1179408289 21:41143001-41143023 GCTGGGGCTGGGAGCCACGGAGG + Intergenic
1180090602 21:45531989-45532011 GCTGCTGCTGGGCCACTCGGTGG - Exonic
1180135582 21:45859895-45859917 GCTGCTCCTGGGGAACACAGAGG + Intronic
1181511770 22:23392595-23392617 GCTGCGGCTGGGGGACACTGGGG - Intergenic
1181546116 22:23603574-23603596 GGAGCTCCTGGGGGACACGGAGG - Intergenic
1181549899 22:23631858-23631880 GCTGGATGTGGGAGCCACGGAGG - Exonic
1181798493 22:25327674-25327696 GCTGGATGTGGGAGCCACGGAGG + Intergenic
1182442787 22:30373907-30373929 GCAGCTCCTGGGACAGACGGAGG - Exonic
1183440206 22:37818683-37818705 GCGGCTCCTGGGAGCCACAGGGG - Intergenic
1184390486 22:44200718-44200740 GCTGTTTCTGGGAGAGACAAAGG + Intronic
1184399734 22:44267013-44267035 GCGGCTTCTGGCAGACAGGACGG + Intronic
1184644145 22:45887005-45887027 GCTGCTTCTCTGTGACACCGCGG + Intergenic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
1184736561 22:46401495-46401517 GCTGGTTCTGGAAGACACAGTGG + Intronic
1184761605 22:46547814-46547836 CCTGCTTCAGGGGGACACAGGGG + Intergenic
1185044792 22:48523495-48523517 TCTGCTTCTGGGAGCCCCGAAGG + Intronic
1185054217 22:48569655-48569677 GCTGATCCTGGCTGACACGGGGG + Intronic
950555812 3:13695342-13695364 GCTGAGGCTGGGACACACGGTGG + Intergenic
951604694 3:24420177-24420199 GCTGGTCCTGGGAGACACTGAGG - Intronic
953826205 3:46253097-46253119 GCTGCATGTGGGAGTCACTGGGG - Intronic
954176166 3:48847539-48847561 GCTGCTGCAGGGCTACACGGTGG - Exonic
954795349 3:53158669-53158691 GCTGCTTCTGGGTGCCACACTGG - Intronic
955356741 3:58237992-58238014 GCCGCTGCAGGGAGACACTGGGG - Intronic
955532804 3:59891646-59891668 CCTGCTGCTGGGAGACACAAAGG - Intronic
957733097 3:84168169-84168191 GCAGCTTGTGGGAGCCAGGGTGG - Intergenic
957734674 3:84190036-84190058 GCTGCTGCAGGGAGACATGATGG + Intergenic
960126617 3:114005692-114005714 GCTGTTGCTGGAAGACATGGCGG + Exonic
960204225 3:114875640-114875662 GTTGCTTCTGGGTGACAATGAGG + Intronic
961501590 3:127340208-127340230 GCTGGGTCTGGGAGTCATGGGGG - Intergenic
962049396 3:131796796-131796818 GCTGCTTCAGTGAGCCACAGTGG - Intronic
962688255 3:137868214-137868236 GCTGCTGCTGGGGGTCAGGGAGG - Intergenic
962753472 3:138451304-138451326 GGGGCTTCTGGGAGCCAAGGTGG + Intronic
967870144 3:194223038-194223060 GCTGCTGCAGAGAGACACGCGGG - Intergenic
968359653 3:198138133-198138155 GCTGCTACTGGGAGAGGCAGCGG + Intergenic
969089180 4:4680445-4680467 GCTGCAGCTGCGAGACACGCAGG + Intergenic
969699967 4:8762500-8762522 GCTGCATCTGGGAGCCAGGACGG + Intergenic
970975088 4:22034379-22034401 GCAGCTCCTGGCAGACACAGGGG - Intergenic
972002311 4:34054064-34054086 GCTGATTTTAGGAGACACAGAGG - Intergenic
972337647 4:38122034-38122056 GAAGCTTCTGTGAGACACAGGGG - Intronic
972471550 4:39410672-39410694 GCTTCTTCTGGGTCACAAGGGGG - Intronic
973771195 4:54208648-54208670 GGTGCTTTTTGGAGACATGGAGG + Intronic
974163224 4:58166935-58166957 GCTGCTTAGGGGAGACAGGGAGG - Intergenic
974600082 4:64067928-64067950 TCTGATTCTGGGAGACTGGGGGG - Intergenic
976818149 4:89174399-89174421 CCTGCTTGTGGGAGACACTGAGG + Intergenic
980575414 4:134679992-134680014 GCTGCTGCACGGAGACACGAAGG + Intergenic
980857078 4:138453362-138453384 CCTGACTTTGGGAGACACGGAGG - Intergenic
981311205 4:143299665-143299687 GCTGATTCAGGGTGACATGGAGG - Intergenic
983000645 4:162409469-162409491 GCTGCTTCAGGGAGGCACAGTGG - Intergenic
983792191 4:171812877-171812899 GCAGCTTCTGGAGGACACCGTGG - Intronic
986398840 5:7359212-7359234 GCTGCTGCTGGATGACTCGGGGG + Intergenic
989772567 5:45162165-45162187 GTAGCTTCTGGGAGACTTGGGGG + Intergenic
992961081 5:81957125-81957147 GCCGCTGCTCGGAGACATGGTGG - Intergenic
997197014 5:131987140-131987162 GAGGCTCCTGGGAGACAGGGAGG + Intronic
1001575932 5:172763813-172763835 GCTGGTTCAGGGAGACAAAGTGG - Intergenic
1004204126 6:13575174-13575196 GCTGCCTCTTGGACACAGGGCGG + Intronic
1004644137 6:17543308-17543330 GCTGCTTCTTGGAGGCAGAGTGG - Intronic
1005902965 6:30235129-30235151 GCTGCTTTATGGAGACAAGGTGG - Intergenic
1007250071 6:40489516-40489538 GCAGCGTCTGGGACACACAGGGG + Intronic
1007410165 6:41656867-41656889 CCTGCTTGTGGGAGAGAAGGTGG + Intergenic
1007971412 6:46055650-46055672 GATGCTTATGGGAGACATGAGGG - Intronic
1019059771 6:169248689-169248711 ACTGCCTCTGGGAGAGACCGGGG + Exonic
1019260338 7:78517-78539 GCTGCTACTGGGAGAGGCAGCGG - Intergenic
1019576497 7:1740163-1740185 CCTGCCTCAGGGAGACACAGAGG - Intronic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1021561065 7:21969041-21969063 TCAGCTTCTGGAAGACACTGGGG - Intergenic
1023311865 7:38895744-38895766 GCTGCTTTTGGCAGAGATGGGGG - Intronic
1023848314 7:44135852-44135874 GCAGTTTCTGGGAGACTCTGAGG - Intergenic
1024783440 7:52878284-52878306 GCTGCTACTGGGAGAAGGGGAGG + Intergenic
1026212033 7:68314287-68314309 CCTGCTTTTGGGAGACACTGGGG + Intergenic
1027173302 7:75888052-75888074 GCTGCGTCTGGGACACAGGGTGG - Exonic
1028527313 7:91800715-91800737 GCTGGCACTGGGAAACACGGTGG + Intronic
1032410853 7:131692516-131692538 GCTGCTTGTGTAACACACGGTGG + Intergenic
1032511149 7:132473368-132473390 ACTGCTTTTGGGAAACACTGGGG - Intronic
1033142210 7:138837932-138837954 TCTGTTTCTGGGAGAGCCGGAGG + Exonic
1033210562 7:139457193-139457215 GGTGCTTCGGGGACACACTGGGG + Intronic
1033945884 7:146717051-146717073 TCTGCTTATGGGATAAACGGAGG - Intronic
1034786549 7:153931615-153931637 GCTGTTTCTGGCAGCCTCGGAGG - Intronic
1034859240 7:154581933-154581955 GCTGCCTCTGGGTGACATGTGGG - Intronic
1038004187 8:23416217-23416239 GCTGCATCTTTGAGACAAGGTGG - Intronic
1038509639 8:28119762-28119784 GCTGCCTCTGGGAGGCGCAGGGG - Intronic
1039023222 8:33229879-33229901 GCTGCTTCTGGAAAACACTTCGG + Intergenic
1039880108 8:41620307-41620329 GCTGCTGCAGGGAGGCACGGGGG + Intronic
1042399893 8:68332390-68332412 ACTGCTTCTGGGAGACGTGGGGG - Intronic
1042721345 8:71830101-71830123 ACTGCTCCTGGGAGAAACTGAGG - Intronic
1043419279 8:80082679-80082701 GCTGCTGCTGGGAGAAGAGGGGG - Intronic
1044437165 8:92177719-92177741 GCAGCTTCTGGGAGATGTGGGGG - Intergenic
1045643733 8:104280406-104280428 GCTGCTTCAGGGAGGCAAGGGGG + Intergenic
1049003643 8:139841470-139841492 GCTGCTTCTGCCAGACAAGCAGG - Intronic
1053199688 9:36143939-36143961 TCAGCCTCTGGAAGACACGGTGG - Intronic
1055723433 9:79201025-79201047 GCTGCTGCAGGGAGACACAGGGG - Intergenic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1060396666 9:123321240-123321262 CCGGTTCCTGGGAGACACGGGGG - Intergenic
1061305491 9:129730357-129730379 GTTGCTACAGGGAGACAGGGAGG - Intergenic
1061675316 9:132212287-132212309 GCGGCTTAGGGGTGACACGGTGG - Intronic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1061890365 9:133616039-133616061 GCAGCTTCTGGGAGACCGGGAGG + Intergenic
1061897073 9:133653800-133653822 GCTGCTTCCGGGAGCCAAAGGGG + Intronic
1062329220 9:136029668-136029690 GCTGACACTGGGAAACACGGTGG - Intronic
1062636352 9:137493647-137493669 GCAGCTTCTGGGGGACAGTGCGG - Intronic
1062744360 9:138201954-138201976 GCTGCTACTGGGAGAGGCAGCGG + Intergenic
1188609273 X:32076146-32076168 GCTGCTAATGGGAGACACAAAGG + Intronic
1189213888 X:39306918-39306940 GCAGTTTCTGGGAGATACTGGGG + Intergenic
1189717625 X:43882181-43882203 GCTGCCTGGGGGAGACGCGGGGG - Intronic
1192601193 X:72466127-72466149 GCTGCTGCTGGGAGATACAGAGG + Intronic
1197476746 X:126934086-126934108 GCTGATTCTGGGAAGCAAGGTGG - Intergenic
1199849791 X:151717297-151717319 GCTTCTTCTGGGAGGCACCCCGG - Exonic