ID: 924501234

View in Genome Browser
Species Human (GRCh38)
Location 1:244639772-244639794
Sequence AAAGGTAAACACTGTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924501229_924501234 -3 Left 924501229 1:244639752-244639774 CCTGTCAGCCTCAAACACTAAAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 236
924501228_924501234 -2 Left 924501228 1:244639751-244639773 CCCTGTCAGCCTCAAACACTAAA 0: 1
1: 0
2: 0
3: 9
4: 145
Right 924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 236
924501227_924501234 1 Left 924501227 1:244639748-244639770 CCTCCCTGTCAGCCTCAAACACT 0: 1
1: 0
2: 0
3: 16
4: 240
Right 924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 236
924501226_924501234 14 Left 924501226 1:244639735-244639757 CCTTGTCTATTTTCCTCCCTGTC 0: 1
1: 0
2: 6
3: 65
4: 674
Right 924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924501234 Original CRISPR AAAGGTAAACACTGTGAGGG TGG Intronic
901231334 1:7643110-7643132 AAATGTAAACACTGAGGGGTGGG - Intronic
902797029 1:18806689-18806711 GAAGGTAAGCTCCGTGAGGGAGG - Intergenic
902894733 1:19471468-19471490 ACATGTAAATACTGTGAGTGTGG - Intronic
904484066 1:30813471-30813493 AAAGGAAAACAAGGTGGGGGTGG - Intergenic
904943546 1:34182218-34182240 AAATGCAAAGACTGTGAGGTGGG + Intronic
905392914 1:37649735-37649757 GAAGGTAAACTCCATGAGGGCGG - Intergenic
906042379 1:42797998-42798020 AAAAGTAAAGAATGGGAGGGTGG + Intergenic
907023605 1:51093902-51093924 AAATTAAAACACTTTGAGGGTGG + Intergenic
909913417 1:81288812-81288834 AAAGTAAAATACTGTGAAGGCGG + Intergenic
910842653 1:91575513-91575535 AAAGGTAAGGACAGAGAGGGTGG - Intergenic
912970121 1:114273520-114273542 AAAAGTAAAAACTGTGAGAGAGG + Intergenic
914193131 1:145428088-145428110 AAAGGCATACACTGGGAAGGTGG + Intergenic
916991950 1:170254013-170254035 ATAGGCTAACACTGTGAGAGAGG + Intergenic
918480307 1:184970904-184970926 ACAGGAAAACACAGTGTGGGGGG + Intronic
920398307 1:205661918-205661940 GAAGGTGAACCCGGTGAGGGCGG + Exonic
920710275 1:208288156-208288178 AAAGGTAAACCCCAGGAGGGAGG - Intergenic
922158614 1:223060667-223060689 AAAGGTACAGATTGTGATGGAGG - Intergenic
922978906 1:229808302-229808324 ACACGTAAACACTGTGATTGGGG - Intergenic
924125135 1:240842615-240842637 AAAGGTAAGCATTTTGGGGGGGG + Intronic
924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG + Intronic
1063366468 10:5493881-5493903 AAAGGTAAATATTGTCAGTGAGG + Intergenic
1065113639 10:22463439-22463461 AAAGGTAAACAGTCAGAGGTGGG - Intergenic
1068550238 10:58399888-58399910 AAAAGTAAAAACTGAGTGGGAGG - Intergenic
1069460122 10:68586738-68586760 TATGGTAAACAGTGTGAGAGTGG + Intronic
1071541248 10:86486276-86486298 AAAGGAAGACACTGTGTGGAAGG + Intronic
1072203474 10:93181444-93181466 AAATGTGAACTATGTGAGGGAGG - Intergenic
1074021253 10:109586426-109586448 AATGGTGAACTCAGTGAGGGAGG + Intergenic
1074729225 10:116350958-116350980 AAAAGTAAACACTGTGTTTGTGG - Intronic
1078591996 11:12649628-12649650 AAAGATAAATACTCTGAGGTGGG + Intergenic
1078982930 11:16558867-16558889 AAATGTAAGCACTGTGAGAGTGG - Intronic
1080607572 11:33876312-33876334 GAATGTAAACTCTGTGAGGGTGG + Intronic
1080862798 11:36164518-36164540 AAAGGAAAATGCTGTGAGTGGGG + Intronic
1081718782 11:45271012-45271034 GATGGTAAACTCTCTGAGGGTGG - Intronic
1084483740 11:69436396-69436418 CACGGTAAGCCCTGTGAGGGCGG - Intergenic
1085778434 11:79387256-79387278 AAAGATAGAGACTGGGAGGGGGG + Intronic
1087805235 11:102548136-102548158 AAAAGCAAACACTGTGAGGCCGG - Intergenic
1087926765 11:103927946-103927968 AAAGGAAAAGAATGTGAGAGGGG - Intronic
1088010771 11:104998386-104998408 AAAGGTAAGAAATGTTAGGGTGG - Intronic
1088993676 11:114977564-114977586 ACACGTAAACACTGTCAGGCCGG + Intergenic
1089772518 11:120813961-120813983 AGAGGGAAACACAGTGAGAGAGG - Intronic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1092345910 12:7714366-7714388 AAAGGTTAACAGTGTGTGTGGGG + Intronic
1093302070 12:17470776-17470798 AAAGGTAGACACGGAGAAGGGGG - Intergenic
1095100555 12:38177924-38177946 GAAGGTAAACAGGGTGAGAGTGG + Intergenic
1095744540 12:45643117-45643139 AAAGGAAAACAATGAGAGGGAGG - Intergenic
1095834833 12:46626232-46626254 TAAGGTAGCCACTGAGAGGGTGG + Intergenic
1096069320 12:48766271-48766293 TAATGTAACCACTGTGGGGGTGG - Intronic
1097012033 12:55959942-55959964 AAATGGAAACACAGTGAGGTGGG + Intronic
1097644996 12:62226006-62226028 AAACCTAAACACTTTGAGGATGG - Intronic
1098546995 12:71722309-71722331 AAAAGCAGACACTTTGAGGGAGG - Intergenic
1098645284 12:72892995-72893017 AAAGGGAAACATTGAGATGGTGG - Intergenic
1101584203 12:106070397-106070419 GAATGTAAATACTGTGAGGGTGG - Intronic
1104544124 12:129695788-129695810 GAAGGAATTCACTGTGAGGGCGG + Intronic
1106388231 13:29308947-29308969 ACAGGTAAACATTGTCTGGGAGG + Intronic
1106764843 13:32903381-32903403 AAAGGAAAGCACAGTGAGTGCGG + Intergenic
1107014931 13:35700662-35700684 AAAAGTAAACACTGGGAGAGTGG + Intergenic
1111456031 13:88485562-88485584 AAAGGCAAAGACTCTGAAGGAGG + Intergenic
1112597849 13:100825352-100825374 AAAGATAAATAATGTGAAGGGGG - Intergenic
1112804377 13:103146772-103146794 AAAGGTAATCACAGGGAGAGAGG - Intergenic
1112957089 13:105073332-105073354 TGAGGTAAACACTGTGGGGTGGG + Intergenic
1113350731 13:109526657-109526679 AAAGGTAGACACAGTGTGGGTGG - Intergenic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1115351047 14:32396264-32396286 AAAGCTAAACACCATGAGGCTGG - Intronic
1116797753 14:49410171-49410193 AAAGGAAAACCCTGTGTGGTAGG - Intergenic
1117228767 14:53693124-53693146 TAAGGTAAACACTGAGGAGGGGG + Intergenic
1118930490 14:70235761-70235783 ATAGGTAAACACTGTCACGGTGG - Intergenic
1118954368 14:70466410-70466432 ATAGGTAAACACTGTCACGGTGG + Intergenic
1119091362 14:71784363-71784385 AAAAGGAAACACTGTGATTGGGG + Intergenic
1119832699 14:77717468-77717490 AAAAATAAGCACTGTAAGGGAGG - Intronic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1120927117 14:89809056-89809078 AAAGGAACATACCGTGAGGGAGG + Intronic
1121701132 14:95954982-95955004 AAAGGTACACAGTGTGGTGGTGG - Intergenic
1121941839 14:98078281-98078303 GAACCTAAAGACTGTGAGGGTGG - Intergenic
1127184351 15:56462622-56462644 AAAGAAAAACACGGTGAAGGAGG + Intronic
1127247377 15:57191951-57191973 AAAGGCCGACAATGTGAGGGTGG + Intronic
1127825136 15:62696334-62696356 GAAGGTAAAAAGTCTGAGGGTGG - Intronic
1128683215 15:69666290-69666312 AAAGGCACACACTGGGAGGAAGG + Intergenic
1130815889 15:87432337-87432359 ACAGCTAAACACTGTGATGCAGG + Intergenic
1132229397 15:100170466-100170488 AAAGGTAGAAACTTTGAGGTAGG - Intronic
1133283622 16:4680646-4680668 AAAGGAAAACACGGTCCGGGTGG - Intronic
1135594328 16:23730106-23730128 AAAGGGAAACAGGGTGAGGCAGG - Intergenic
1138077386 16:54056285-54056307 AACTGTAAACTCTGTGAGGGCGG + Intronic
1138344907 16:56314726-56314748 AAATGTTAACACTGTTAGGAAGG + Intronic
1138830506 16:60368963-60368985 AATGGTAAAGACTGTGAGACAGG + Intergenic
1143913218 17:10269301-10269323 AATTGTAAACACTGTGAGAAGGG - Intergenic
1146031487 17:29370057-29370079 ACAGGCAAACAATGTGAAGGTGG + Intergenic
1146713648 17:35064986-35065008 AAAGGAAAACACTGAAGGGGAGG - Intronic
1147045636 17:37749919-37749941 AAATGTAAACAGTGTGGGGCCGG + Intergenic
1147467712 17:40623938-40623960 AATGGTAAAAATTGTGATGGTGG + Intergenic
1148380475 17:47193175-47193197 AAGAGTAAACATGGTGAGGGTGG - Intergenic
1148992532 17:51679055-51679077 AATGGTAAACTCTTTGAGGGTGG - Intronic
1149107618 17:52988269-52988291 AAATGTAAACTCAGTGAAGGTGG - Intergenic
1151547114 17:74799925-74799947 CAAGGTAAACCGTGGGAGGGCGG - Intronic
1151874924 17:76862383-76862405 AAAGGTAACCACTGTGTCTGGGG - Intergenic
1152516184 17:80826191-80826213 ACAGCAAGACACTGTGAGGGAGG - Intronic
1153993277 18:10418720-10418742 AAATGTAAACACAATGAGAGAGG + Intergenic
1155985477 18:32226485-32226507 AAATGTAAACACAGTGAAAGAGG + Intronic
1156053142 18:32963296-32963318 GAATGGAAACACTGTGAGGTGGG - Intronic
1156486927 18:37472263-37472285 AATGGAAACCACTGTGAGAGTGG - Intronic
1157793330 18:50552713-50552735 AAAAGCAGACACTTTGAGGGAGG - Intergenic
1158590166 18:58772439-58772461 AAAGATAAACACTTTGAAGAGGG + Intergenic
1160099258 18:75904953-75904975 AAAGGGGAGCACTGTGAAGGCGG - Intergenic
1160517330 18:79485741-79485763 AAAGAAAAACACTGTCATGGAGG - Intronic
1161539662 19:4842621-4842643 AAAGGCACACACTGGGAGGTAGG + Intronic
1162320827 19:9969927-9969949 GAAGGGAAAGACAGTGAGGGGGG + Intronic
1164509430 19:28885452-28885474 AGAGGTAAAAACTGTGGGGTTGG - Intergenic
1165276367 19:34755445-34755467 AGAGGTGGTCACTGTGAGGGAGG + Intergenic
1167173572 19:47849879-47849901 AAAGACAATGACTGTGAGGGAGG + Intergenic
1168713764 19:58515763-58515785 AGAGGTAAAGAGTGGGAGGGTGG - Intronic
925254366 2:2469917-2469939 AAAGATAAAATCTGTGAGCGTGG + Intergenic
925554069 2:5110028-5110050 AAGGCTAATAACTGTGAGGGAGG - Intergenic
925859809 2:8163412-8163434 AAAGAAAAGCACTGTGAGGAAGG - Intergenic
926559892 2:14405192-14405214 AAAAGTAAACACAGTGAAGAAGG + Intergenic
926717456 2:15936290-15936312 AAATGTACACATTTTGAGGGAGG + Intergenic
929025926 2:37601813-37601835 ACAGCTAAACATTGGGAGGGAGG + Intergenic
929037678 2:37710342-37710364 AAAAGTAAAAACAATGAGGGAGG + Intronic
931867832 2:66431599-66431621 AAATGGAAAGACTGTGGGGGGGG + Intergenic
931955124 2:67415047-67415069 GAAGGTAAACAATATGAGTGGGG + Intergenic
933793267 2:85900529-85900551 GCAGGAAAACACTGAGAGGGTGG - Intergenic
935012692 2:99150344-99150366 AAATGTAAACACTGAAAGGTAGG + Intronic
935522026 2:104119093-104119115 AAAGGTAGAGACTTTAAGGGAGG + Intergenic
936731627 2:115388134-115388156 AAATGTAAACCCCGTGAGGTGGG + Intronic
937575554 2:123417288-123417310 ATAGGTAAACTCTGTCATGGGGG + Intergenic
938249120 2:129799882-129799904 AAATGTGAACACTGCGAGGGAGG - Intergenic
939603719 2:144226342-144226364 AAAGGTAAAAATAATGAGGGAGG + Intronic
940090357 2:149909465-149909487 TAAGGTAAACACTGTGTTGGAGG + Intergenic
941648270 2:168065420-168065442 AAAGGGAGACACGGTGAGTGTGG + Intronic
942552947 2:177138841-177138863 ATGGGTAAACACTGTGATAGTGG + Intergenic
944293357 2:198033650-198033672 AAAGGTAAACAAGATGAGGTTGG - Intronic
946224128 2:218253499-218253521 AGAGGTATACACTGTGTAGGAGG + Intronic
948705339 2:239788802-239788824 AAAGGTACACTCTGAGAGGCAGG + Intronic
1170120687 20:12908330-12908352 AGATGTAAACAGTGTGAGGGTGG + Intergenic
1172247846 20:33458175-33458197 AAAGAGAACCAGTGTGAGGGTGG + Intergenic
1172823965 20:37764189-37764211 AAACCGAAACACTGAGAGGGAGG + Intronic
1173589632 20:44214445-44214467 AAAGGGATACACAGTGAAGGGGG - Intergenic
1173613732 20:44389312-44389334 AAACGCAAGCTCTGTGAGGGAGG + Intronic
1175793681 20:61758034-61758056 GAAGGTAAGCTCGGTGAGGGCGG - Intronic
1178361554 21:31952728-31952750 AAAGGCAGACACTGGGTGGGGGG - Intronic
1179971241 21:44837551-44837573 AAAGGTAAAGAAGGAGAGGGTGG + Intergenic
1180121598 21:45753491-45753513 AAAGGCAAAGATTGTCAGGGAGG - Intronic
1181331923 22:22099311-22099333 AATGGTCAACACGGTGAGTGAGG + Intergenic
1183168637 22:36167123-36167145 AAAGGTAAAGAGTGGGAAGGAGG + Intergenic
1183570544 22:38650048-38650070 AATGGTGAAGACTGTGAGGAAGG - Exonic
1183865078 22:40697975-40697997 GAAGGCAGAGACTGTGAGGGAGG + Intergenic
1184152112 22:42645310-42645332 AAATAAAAACACTGGGAGGGTGG - Intronic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
949552343 3:5121825-5121847 AAAAGTAAGCACTTTGAGAGAGG - Intergenic
950871490 3:16233565-16233587 AAAGATAAAGAAAGTGAGGGAGG - Intergenic
951145679 3:19223917-19223939 AAAGGTATTCAATGTCAGGGAGG + Intronic
951875799 3:27423863-27423885 TAAGGTAAAAACTGTGAGAAGGG - Intronic
952624253 3:35384486-35384508 CAAGCTAAACTCTGTGAGGTCGG - Intergenic
953263508 3:41363276-41363298 AAGGGTCAAGACTTTGAGGGAGG + Intronic
953573817 3:44096726-44096748 GAATGTAAACTCTGTGAGGGTGG - Intergenic
957200886 3:77134757-77134779 AAAGGAAAAGATTGTGAAGGAGG + Intronic
958971447 3:100615079-100615101 AAAGGCAGGCACTGTGAGGAAGG + Intronic
960160491 3:114345297-114345319 GAATGTAAACTCTGTGAGAGCGG - Intronic
960196602 3:114776173-114776195 AAAGGTAAACATGGTGTGGTGGG + Intronic
960885831 3:122393596-122393618 AAAGATAAGCCCTGTGAGTGGGG - Intronic
961646888 3:128397482-128397504 AAAGGCAGTCACTATGAGGGTGG + Intronic
963475614 3:145799885-145799907 AAGGGTAAACACTTGGAAGGAGG - Intergenic
963644364 3:147895246-147895268 AAAGGCACACACTTTGAAGGAGG - Intergenic
964832349 3:160898353-160898375 AAATGTCAACACTGTCAGGTGGG + Intronic
966682766 3:182660811-182660833 AAAGGGAAACATTGTGAAGTTGG + Intergenic
967480345 3:189965664-189965686 AAAGGTAAAACCTGTGAAGTAGG + Intronic
967634844 3:191789544-191789566 AAAGGTAAGGACTGTGAGTGTGG - Intergenic
971134810 4:23856722-23856744 AAAGGTAAATTCCATGAGGGAGG - Intronic
972316423 4:37930885-37930907 AAAGATAAAAACTGTGAGAAAGG + Intronic
973589177 4:52423232-52423254 ATATGTTAAAACTGTGAGGGTGG - Intergenic
975845665 4:78522805-78522827 ACAGGTAAATACAGTGATGGAGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
980714931 4:136616119-136616141 AAAGGTGAACACAGTGGGGAGGG - Intergenic
980947583 4:139338082-139338104 AATGTTAAACTCTTTGAGGGTGG + Intronic
982195348 4:152906365-152906387 AATGGCAAAGACTGTGAGAGGGG - Intronic
982256710 4:153458119-153458141 TATGGGAAACAGTGTGAGGGAGG + Intergenic
983257819 4:165421599-165421621 AAAGGTATACTATGTGAAGGTGG - Intronic
985910339 5:2874653-2874675 TAAGACAAACCCTGTGAGGGTGG + Intergenic
986181015 5:5393017-5393039 ACAGGGACACACTGTGATGGTGG + Intergenic
986444371 5:7808375-7808397 GAAGCTAAACACTGTCTGGGAGG - Intronic
987707112 5:21471503-21471525 ACAGGGACACACTGTGATGGTGG - Intergenic
988959073 5:36350933-36350955 GAAGGTAACCACTGTGGGAGAGG + Intergenic
989164995 5:38425071-38425093 AAAGGTCGACACTGTGAAGATGG + Exonic
990533223 5:56694469-56694491 CAAGGTAAAAATTGTGAAGGTGG - Intergenic
990709616 5:58565467-58565489 TGAGATAAACACTTTGAGGGAGG - Intergenic
990849525 5:60186963-60186985 AAAGGAAGACACTTTGCGGGAGG + Intronic
992873312 5:81027160-81027182 AAAAGAAAACACAGTGATGGTGG + Intronic
993318788 5:86445791-86445813 CAAGGTAAATATTGTGAAGGGGG + Intergenic
996081739 5:119265149-119265171 AAAAGTAAACACTGAGACAGTGG + Intergenic
998918961 5:147046731-147046753 ACAGGTAAAAATAGTGAGGGAGG - Intronic
999360597 5:150982966-150982988 AAAGCTACACACTGTGGGGTGGG + Intergenic
999516555 5:152307624-152307646 AAAGGCAGGCACTTTGAGGGAGG + Intergenic
1001013365 5:168118465-168118487 AAAGGCGAGCACTGTGAGGAAGG + Exonic
1002254680 5:177950475-177950497 AGAGGTAAACACTGAGGGGCTGG - Intergenic
1002483158 5:179516783-179516805 AGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483213 5:179516987-179517009 AGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483226 5:179517038-179517060 AGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483239 5:179517089-179517111 AGAGGGAAACACTGAGGGGGTGG + Intergenic
1002483280 5:179517242-179517264 AGAGGGAAACACTGAGGGGGTGG + Intergenic
1002821837 6:732922-732944 AAATGTAACCACTGTGAGATAGG + Intergenic
1004203321 6:13570080-13570102 AATGGTAAACATTGGGAGAGTGG + Intergenic
1004485459 6:16062368-16062390 AAACATAAACTCTGTAAGGGTGG - Intergenic
1005590155 6:27315309-27315331 AAAGGCAGAGACTGTCAGGGTGG + Intergenic
1006261196 6:32872830-32872852 ATAGGTAAACAGTGTCATGGAGG + Intergenic
1007750389 6:44067548-44067570 AAATGTATACACTGTAAGGTCGG - Intergenic
1009021115 6:57949005-57949027 ACAGGGACACACTGTGATGGTGG + Intergenic
1009766199 6:68079089-68079111 AAAAGCAATCACTGAGAGGGAGG - Intergenic
1011836202 6:91434219-91434241 GAAGGGAAACACTGTTAGTGAGG + Intergenic
1012433093 6:99186663-99186685 AAAGGAACACAATGTGAAGGAGG + Intergenic
1012645773 6:101679256-101679278 CAAGGTCAACAATATGAGGGGGG - Intronic
1012911403 6:105121939-105121961 GCAGGTAAAAAGTGTGAGGGTGG + Intronic
1012973256 6:105753874-105753896 AAAGGGAAATACTGTGAGACGGG + Intergenic
1014549545 6:122773952-122773974 AAAGGTAACAACTCTGAGTGAGG + Intergenic
1014582298 6:123153828-123153850 AAAGGTAAACAATTTCTGGGAGG - Intergenic
1014945016 6:127487434-127487456 ATAGGGTAACACTGGGAGGGAGG + Intronic
1016264855 6:142220884-142220906 GAATGTAAACTCTATGAGGGAGG - Exonic
1016459263 6:144264929-144264951 CAAGGTAACCACTGAGAGGCTGG + Intergenic
1023448152 7:40253327-40253349 AACTGGAAACACTGTGAGGGTGG - Intronic
1025689730 7:63748091-63748113 AAAAGAGACCACTGTGAGGGAGG - Intergenic
1029098015 7:98104679-98104701 AAAGGCATACACGGTGAGGTGGG + Intergenic
1030275975 7:107722202-107722224 ATAGGTAAACACTCTGAGTCAGG + Intergenic
1032071598 7:128811150-128811172 AGAAGTCAACACTGTGAGGCTGG + Intronic
1032071889 7:128812926-128812948 TGAGGTAACCACTGTCAGGGAGG + Exonic
1034983328 7:155491845-155491867 AAAGGAAAATGCTGAGAGGGGGG + Intronic
1038464439 8:27748261-27748283 AAAGGTAAAAATTGTGACAGTGG - Exonic
1039070968 8:33649000-33649022 AAAAGCAAGCACTTTGAGGGAGG + Intergenic
1039184660 8:34903734-34903756 ACAGAGAAACAATGTGAGGGTGG - Intergenic
1043577271 8:81672564-81672586 AAAGGGACACACTGGGAGAGGGG - Intronic
1044575443 8:93763938-93763960 ACAGGTAAGCAGTGTGATGGGGG + Exonic
1045552179 8:103182582-103182604 ACAGTCAAACACTGTGAGGATGG - Intronic
1045607989 8:103799952-103799974 AAAGGTAAAAACTGTAAAGCTGG - Intronic
1045921922 8:107540394-107540416 AAAAGCCAACACTGGGAGGGAGG + Intergenic
1046295416 8:112213550-112213572 ACAGATATACACTCTGAGGGGGG + Intergenic
1046617800 8:116496729-116496751 AGATGTAAACTCTGTGAGGCTGG - Intergenic
1046829317 8:118726847-118726869 GAAGATTAACACTTTGAGGGTGG + Intergenic
1047319361 8:123765068-123765090 AAGGGTAAAAACTGGGAGGTGGG + Intergenic
1047918415 8:129607444-129607466 AAAAGCAAACACTGTGAGACTGG - Intergenic
1049128793 8:140817553-140817575 AAAGTAGAACAGTGTGAGGGTGG - Intronic
1049579038 8:143402630-143402652 AAAGGAGAACGCTGTGAGGCCGG - Intergenic
1051529526 9:18084708-18084730 AAAGGAAAGCAATGGGAGGGTGG - Intergenic
1054834327 9:69660535-69660557 AAAGGAAAAGAATGTCAGGGAGG - Intronic
1057724193 9:97556663-97556685 TAATGTAGACTCTGTGAGGGTGG - Intronic
1058301885 9:103384992-103385014 AAAGGTGAAGACTGAGAGGATGG + Intergenic
1058549048 9:106093676-106093698 AAAGGCAGACACTCTCAGGGTGG - Intergenic
1058699684 9:107589889-107589911 AAAGGACAACACCGTGGGGGAGG - Intergenic
1059294504 9:113257782-113257804 ATAAGTAAACACTCTGAGGCCGG - Intronic
1059988942 9:119846581-119846603 AAAGGTTACTCCTGTGAGGGTGG - Intergenic
1060307819 9:122432356-122432378 AAAAGTAACCACTGTTAGGGAGG - Intergenic
1185484782 X:474055-474077 AAAGATAAACACTGTGGGGCCGG - Intergenic
1186534832 X:10335985-10336007 AAAGGAAAAAAATGTGAAGGAGG - Intergenic
1188412635 X:29892716-29892738 AATGGGAAACAATGTGAGGATGG + Intronic
1188947719 X:36327934-36327956 AACAATAAACACTGTGAGGGTGG + Intronic
1189499181 X:41539100-41539122 AAACTTAAACACTGTGTGTGTGG + Intronic
1189643435 X:43099477-43099499 AAAGTTATATTCTGTGAGGGAGG - Intergenic
1193802315 X:85951638-85951660 AAAAGTCAACAATGAGAGGGTGG + Intronic
1195334656 X:103839620-103839642 AAAGAGAAACTCTGTGAGTGGGG - Intergenic
1195929779 X:110063174-110063196 AAAGGGAAACAGAGTGAGAGAGG - Intronic
1195951299 X:110276726-110276748 CAAGGGCAACACTGTGAGGCTGG - Intronic
1196906659 X:120443733-120443755 AAAGAGAAACATTGTGAGGCAGG + Intronic
1197154211 X:123252573-123252595 AAAGGTGACAACTGTGAGGGGGG + Intronic
1198199420 X:134400371-134400393 AAAGGCAAAGGCTGGGAGGGTGG - Intronic
1199900029 X:152164023-152164045 CAAGGGAAGAACTGTGAGGGTGG + Intergenic