ID: 924503583

View in Genome Browser
Species Human (GRCh38)
Location 1:244659548-244659570
Sequence CTCCATCTTCAGACCGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 9, 3: 24, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924503580_924503583 9 Left 924503580 1:244659516-244659538 CCTCTCTCAGTTGCTTCAAGTGT 0: 1
1: 0
2: 2
3: 21
4: 232
Right 924503583 1:244659548-244659570 CTCCATCTTCAGACCGGCAATGG 0: 1
1: 0
2: 9
3: 24
4: 156
924503579_924503583 27 Left 924503579 1:244659498-244659520 CCTGCTGTCAGCTGGGATCCTCT 0: 1
1: 0
2: 3
3: 21
4: 219
Right 924503583 1:244659548-244659570 CTCCATCTTCAGACCGGCAATGG 0: 1
1: 0
2: 9
3: 24
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924503583 Original CRISPR CTCCATCTTCAGACCGGCAA TGG Intronic
900364859 1:2307147-2307169 CGCCATCTGAAGACCCGCAACGG + Exonic
902668792 1:17957736-17957758 CTCCAACTTCAGAGCTGGAAGGG - Intergenic
903551806 1:24162308-24162330 CTCCATCGTCAAACCAGAAACGG + Intronic
904617800 1:31759391-31759413 ATCCAGCTTCAGACATGCAAAGG - Intronic
906968606 1:50485921-50485943 CTCCATCATGAGAACAGCAAGGG + Intronic
908633778 1:66139396-66139418 CTCCATCTTCAAGCCAGCAAAGG + Intronic
909833915 1:80230333-80230355 CTCTATCGTGAGACCAGCAAGGG + Intergenic
910529448 1:88218922-88218944 CTCCACCTTTAAACCAGCAAAGG - Intergenic
910556723 1:88542654-88542676 CTCCCTCTTCAAACCAGCCATGG - Intergenic
913227032 1:116709464-116709486 ACCCATCTTCAGACTGGAAAGGG + Intergenic
916602262 1:166304534-166304556 CTTCATCTTCAAATCAGCAATGG + Intergenic
917705119 1:177624675-177624697 CTCCATCATGAGAATGGCAAGGG + Intergenic
918295477 1:183152286-183152308 CTCCTCCTTCAAACCAGCAATGG - Intergenic
918660552 1:187082511-187082533 CTCCATCTACAGAACTGGAAAGG + Intergenic
919493779 1:198238330-198238352 CTCCTTTTTCAGAGGGGCAAGGG + Intronic
920664676 1:207954258-207954280 CTCCATCTTCAAGCCAGCAGTGG + Intergenic
922479789 1:225931634-225931656 CCTCATCTTCAGACCAGCAATGG + Intergenic
923892943 1:238235798-238235820 CTCCATCTTCAGACAAGCAATGG - Intergenic
924503583 1:244659548-244659570 CTCCATCTTCAGACCGGCAATGG + Intronic
924796152 1:247293765-247293787 CACCATCTTCACAGTGGCAATGG - Intergenic
1064016163 10:11774004-11774026 ATCCATCTTCACAACAGCAAAGG + Intergenic
1069114568 10:64489208-64489230 CTCCATCATGAGAACAGCAAGGG + Intergenic
1069887787 10:71634792-71634814 CTCCATCTACAGAACTGGAAAGG + Intronic
1069945436 10:71982280-71982302 CTCCATCTGCAAACCAGCAATGG - Intronic
1073462343 10:103673154-103673176 CACCATCTTCAGAGCAGCCAAGG - Intronic
1076723149 10:132401506-132401528 CTCCATCTTCCCACCTGCCAAGG + Intronic
1077395406 11:2318067-2318089 CTCCACCTTCAAACCAGCAATGG + Exonic
1080355592 11:31440912-31440934 CTGCATCTCAAGACTGGCAATGG + Intronic
1081597200 11:44467445-44467467 CTCCACCTTCTGACCAGCAGGGG + Intergenic
1084439809 11:69166370-69166392 CTCCACATGCAGACCGGCCATGG - Intergenic
1086088559 11:82981950-82981972 CTCCAACTCCAGACTGGAAAAGG + Exonic
1089158510 11:116420449-116420471 CTCCATCTGCGGGCCAGCAAGGG + Intergenic
1089805299 11:121082360-121082382 TGCCATCTTCAAACCAGCAATGG + Intronic
1090394800 11:126411772-126411794 CTCCATCTTCAAGCCAGCGACGG + Intronic
1092636290 12:10454341-10454363 TTCCATCTCCAGACCTGAAAAGG + Exonic
1093545873 12:20346990-20347012 GTCCATCTTCAAACCAGCAATGG + Intergenic
1094390326 12:29942104-29942126 CTCTATCTTCAAGCCAGCAATGG + Intergenic
1095620084 12:44242438-44242460 CTCCATCGTCATCCCTGCAAAGG + Intronic
1095973882 12:47926031-47926053 CTCCATCTTCAAGTCAGCAATGG - Intronic
1098055941 12:66505261-66505283 CTCCATCTTCAAGACAGCAACGG - Intronic
1100822424 12:98443970-98443992 CTCCATCTTCAAGTCAGCAATGG + Intergenic
1102045581 12:109828206-109828228 CCTCATCTGGAGACCGGCAAGGG + Intronic
1103240617 12:119410429-119410451 CTCCATCTTCAGTCCTTCACTGG + Intronic
1103480979 12:121249505-121249527 CACCCTCTGCAGACCGGCATGGG - Intronic
1103514807 12:121500605-121500627 CGCCATCCACAGGCCGGCAAAGG + Intronic
1106001067 13:25723940-25723962 CTCCATCTTCAAACCAGCCACGG - Intronic
1107282961 13:38757348-38757370 CTCAATATTCAGACAAGCAACGG - Intronic
1108251155 13:48569440-48569462 CTCAATCTTCAGACATGGAATGG + Intergenic
1111607958 13:90564465-90564487 CTCCTTCATCAGACATGCAATGG - Intergenic
1115534368 14:34358662-34358684 CTCCATCTTCAGAAAGGAAGGGG - Intronic
1116778660 14:49211641-49211663 TTCCATCTTCAAGCTGGCAATGG + Intergenic
1119053672 14:71395966-71395988 CTCCATCATCAGACCTGGATGGG - Intronic
1119436616 14:74601611-74601633 CTGCATCTTCAAACAGGCAGAGG + Intronic
1120807190 14:88765438-88765460 CTCCATCTTCCAATCAGCAACGG + Intronic
1124033672 15:26033801-26033823 CCCCATCTTCAAACCAGCAATGG + Intergenic
1124052513 15:26210879-26210901 CTCCAGCAGCAGACAGGCAAAGG + Intergenic
1125395796 15:39246226-39246248 CTCCATCTTCAAGCCAGCAATGG + Intergenic
1127718625 15:61677142-61677164 CTCCATCTTCAAGCCAGCAGTGG - Intergenic
1129627259 15:77214834-77214856 CTCTATCATGAGAACGGCAATGG + Intronic
1129801200 15:78415882-78415904 CACCATCTTCGGATCGCCAAAGG + Intergenic
1133479997 16:6160973-6160995 CTCCTTCTTCCTACCGACAATGG + Intronic
1133859387 16:9579979-9580001 CTCCATCATCTGCCCGGCTAGGG + Intergenic
1135381948 16:22003027-22003049 CTCCATCTTCCTACCAGCAGGGG + Intergenic
1136417911 16:30114560-30114582 CTCCAGCTTCAGGCAGGCCAAGG - Exonic
1138232762 16:55351322-55351344 CTCCTTCTTCTGACAGGTAAAGG - Intergenic
1139589266 16:67924422-67924444 CTCCATCTTCAGAGTGGCACAGG - Intronic
1139969797 16:70766688-70766710 CTCCACCTCCAGCCAGGCAAGGG - Intronic
1140944076 16:79751213-79751235 CTCCATCTTCAAACCAGCAATGG - Intergenic
1142311186 16:89314927-89314949 CTCCAGCATCAGACCCTCAAGGG + Intronic
1144762607 17:17715805-17715827 CTCCAAGTTCACACCCGCAAAGG - Intronic
1147506390 17:41021692-41021714 CTCCATCTTCAAACCAGCAGTGG - Intergenic
1149591146 17:57830853-57830875 CTCCATTTTCAGATGGGAAAAGG - Intergenic
1155402398 18:25453532-25453554 CCCCAACTTCAGACCTGCCAAGG - Intergenic
1155624294 18:27816616-27816638 CTCCATCCACATACCTGCAAAGG + Intergenic
1156196083 18:34775590-34775612 TTCCATCTTCAAGCCAGCAATGG - Intronic
1156258123 18:35418707-35418729 CTCCATCTTCAAACAAGCAATGG + Intergenic
1157056310 18:44233235-44233257 CTCCATCTCCAGGAAGGCAATGG + Intergenic
1157128126 18:44977086-44977108 CTCCATCTCCAGCCCTGAAATGG + Intronic
1157634203 18:49133642-49133664 CTTCATCTTCAAACCAGCAATGG + Intronic
1159772294 18:72560184-72560206 CTCCCTCTTTAGACCCACAAGGG - Intronic
1161503193 19:4628984-4629006 CTCCATCTCCAAGCCAGCAAGGG + Intergenic
1162957193 19:14105972-14105994 CTCCCTCTCCAGGCCGGCCATGG - Intronic
1163082969 19:14956754-14956776 TGCCACCTTCAGACCTGCAAGGG - Intronic
1163514536 19:17755106-17755128 CTCTCTCTTCAGACAGGCACTGG + Exonic
1168291171 19:55358438-55358460 TTCCCTCTTCAGACTGGCAGAGG + Exonic
925795169 2:7533389-7533411 CTCCTTCTTCAAGCCAGCAAGGG + Intergenic
927003861 2:18827250-18827272 CTCCATCTTCAGGCCAGCAATGG + Intergenic
927726831 2:25431520-25431542 CTCCAACTTCAGACCCTCATTGG + Intronic
931078241 2:58740596-58740618 TTCTATCTTCAAACTGGCAATGG + Intergenic
936662771 2:114560506-114560528 CCCCATCTTCCTACCAGCAAAGG - Intronic
937083475 2:119156582-119156604 CTCCATCCCCATCCCGGCAAGGG - Exonic
938722643 2:134080006-134080028 TTCCATCTTCAAGCCGGCAGTGG + Intergenic
940285388 2:152028252-152028274 TGCCATCTCCAGACCAGCAAAGG + Intronic
942716570 2:178899783-178899805 CTCCATCTTCACTCCAGCAGTGG + Intronic
942779361 2:179623094-179623116 CTGGATCTTCAAACTGGCAATGG + Intronic
943190149 2:184665814-184665836 CTCTATCTTCAAACCAGAAAAGG + Intronic
943422209 2:187680306-187680328 CTCCAGCTTCATCCCTGCAAAGG - Intergenic
943781345 2:191827673-191827695 CTCCATCTTCAAGCCAGCAATGG - Intergenic
945738511 2:213631543-213631565 CTCCATCATGAGAACAGCAAGGG - Intronic
947824129 2:233092790-233092812 TTCCATCTTGAGACAGGCCAAGG + Intronic
1169545758 20:6648979-6649001 CTCCATCTTCAAAGCTACAATGG - Intergenic
1170004159 20:11647098-11647120 CTCCACCTTCAGGCCAGGAAGGG + Intergenic
1170070106 20:12357554-12357576 CTCCCACTCCAGACCTGCAATGG - Intergenic
1170389190 20:15853548-15853570 CTCCATCCTCAAGCCAGCAAAGG - Intronic
1171337944 20:24403508-24403530 TTCCATATTCTTACCGGCAATGG + Intergenic
1172823463 20:37759379-37759401 TTCCCTATTCAGACAGGCAAAGG - Intronic
1173022325 20:39277303-39277325 CTCCAGCTTAAAACCGACAATGG - Intergenic
1176247103 20:64102517-64102539 CCCCATCCACAGACCAGCAATGG - Intergenic
1177076992 21:16588434-16588456 TTCCATCATCTGACCTGCAAAGG + Intergenic
949567152 3:5255451-5255473 CTCCATCTTCAAGCCAGAAAAGG + Intergenic
951357321 3:21683724-21683746 CTCGATCTTCAGGCCAGTAAGGG - Intronic
952592295 3:34971240-34971262 CTCCATTTTAAAACCAGCAATGG - Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
956232762 3:67035650-67035672 CTCCACCTTCAGACCCGCAATGG + Intergenic
956389230 3:68753740-68753762 CTCCATCTTCAAGCCAGCAATGG - Intronic
956816935 3:72916268-72916290 CTACATCTTCAGACTGGCAAGGG - Intronic
962785955 3:138768551-138768573 CTCCATCTTCAGGCCAGGGAGGG - Intronic
964213950 3:154258531-154258553 TTCCATCTTCAAAGCAGCAATGG + Intergenic
964991074 3:162813473-162813495 GTCCAATTTCAGACCGGCCACGG + Intergenic
966956007 3:184879765-184879787 CTCCATCTCCCAACTGGCAAGGG - Intronic
967550604 3:190790329-190790351 CACCATCTTCAAACCAGAAAGGG - Intergenic
970899572 4:21143303-21143325 CTCTATCTGCAAACCAGCAATGG - Intronic
971589869 4:28453630-28453652 CTCCATCTACATCCCTGCAAAGG + Intergenic
971938837 4:33188858-33188880 CTCCACCTTCAGACCAGGGAGGG - Intergenic
974366866 4:60961605-60961627 CTCCACCTTCAAACCAACAATGG - Intergenic
974403503 4:61435498-61435520 TTCCATTTTCACACCGGTAATGG - Intronic
976664245 4:87573013-87573035 TTCCATCTTCAAGCCAGCAATGG + Intergenic
977155862 4:93572783-93572805 CTCCATATTCTGACCAGGAAAGG - Intronic
979145351 4:117239899-117239921 CCCCATCTTCAGACCAGGGAGGG + Intergenic
980005167 4:127533404-127533426 CTCCATCTTCAAGCCAGCAATGG + Intergenic
986733994 5:10654764-10654786 CTCCAACGTCAGACCGGGAGCGG - Intergenic
988452291 5:31355625-31355647 CTCCATCTTTAAGCCAGCAATGG + Intergenic
992094449 5:73348643-73348665 CTCCATCATGAGAACAGCAAGGG - Intergenic
993195076 5:84731854-84731876 CTCCATCTTTAAACCACCAAAGG + Intergenic
997389495 5:133502343-133502365 CTCCATCTTCAAATTGGCAGTGG - Intronic
997604819 5:135167126-135167148 CTCCACCTTCTGTCCGGCATTGG - Intronic
1003825801 6:9950157-9950179 TTCCATCTTCAAGCCAGCAATGG + Intronic
1009523888 6:64719079-64719101 CTTCATCTTCAAATCAGCAATGG - Intronic
1009892708 6:69707169-69707191 CTCCATCTTCAAACCAGTCATGG + Intronic
1011153909 6:84307405-84307427 CTCCATCTACATCCCTGCAAAGG + Intergenic
1013627132 6:111949656-111949678 CTCCATCTTCTGGTCAGCAATGG - Intergenic
1016742947 6:147547524-147547546 TTCCATCTTCAAACCAGCAATGG + Intronic
1017057850 6:150453997-150454019 CTCCATCATGAAACTGGCAAAGG + Intergenic
1018918677 6:168155275-168155297 CTCCATCTTCTGATGGGCCATGG - Intergenic
1019125466 6:169837742-169837764 CTCCCTCTTCAGACCAGCAATGG - Intergenic
1019830527 7:3323611-3323633 CTCCATCTTCAAACCAGCAATGG + Intronic
1021398658 7:20183236-20183258 CTCAGTCTTCAGTCCAGCAATGG - Intronic
1023109207 7:36793099-36793121 TTCCATCTTCAAACCAGAAATGG - Intergenic
1023752560 7:43386111-43386133 CTCCATCTTCCAGCCTGCAATGG + Intronic
1023973160 7:45006632-45006654 CTCCATCTTCAGGCCAGGCATGG - Intronic
1024180523 7:46888744-46888766 CTCCATCATGAGAACAGCAAGGG + Intergenic
1027206032 7:76100249-76100271 CTCCATCATCAGGCCGGGCACGG + Intergenic
1035817592 8:2557771-2557793 CTCCTTCTTCAAGCCAGCAAGGG + Intergenic
1035909986 8:3555448-3555470 CTCCACCTTCTGACCTGCCAGGG - Intronic
1039350421 8:36758028-36758050 CTCCATCTCCACACCAGCAATGG + Intergenic
1041110207 8:54476491-54476513 CTCCACCTTCACACCAGCATTGG - Intergenic
1041590569 8:59577062-59577084 TTCCATCTTCAAGCCAGCAATGG - Intergenic
1044098690 8:88102217-88102239 CTCCCTCTTCAGACAAGCAGTGG + Intronic
1044340972 8:91045760-91045782 CTCCATCCTCAGGCCAGCAATGG - Intergenic
1044946424 8:97394046-97394068 CTCTTTCCTCAGACCAGCAATGG - Intergenic
1048719194 8:137303568-137303590 CTCCATCTTCAAACCATCAATGG + Intergenic
1050643259 9:7692007-7692029 CTCCATCATGAGAACAGCAAGGG - Intergenic
1051907507 9:22113286-22113308 CTCCATCTTCAGGCCAGCAATGG + Intergenic
1055061820 9:72076747-72076769 CTCCATCATCAGCCAGGCATGGG + Intergenic
1057853336 9:98582290-98582312 CTTCATCTTCAAACCAACAATGG - Intronic
1058280116 9:103103518-103103540 CTCCACCTTCAGACCAGGGAAGG + Intergenic
1059262201 9:112988446-112988468 CTCCATCCACAGCCCTGCAAAGG + Intergenic
1059738032 9:117121907-117121929 CACCATCTTGAGAACAGCAAGGG + Intronic
1061400145 9:130364081-130364103 CACCATCTTCACTCCAGCAAAGG - Intronic
1061843244 9:133372434-133372456 CACCATCTTCAGATGGGCAGAGG - Intronic
1061920306 9:133778876-133778898 CACCATCTTGGGACCTGCAAAGG + Exonic
1062605598 9:137347365-137347387 CTCCATCTTCAAGCCAACAATGG + Intronic
1187111649 X:16307857-16307879 CTCCATCTTCAAGCCAGGAAGGG - Intergenic
1188102457 X:26106629-26106651 CACCATCTTCAAACCAGCAATGG - Intergenic
1188798231 X:34493165-34493187 CTCCATCTTTAAACCAGCATGGG + Intergenic
1189530089 X:41871156-41871178 TTCCATCTTCAAGCCAGCAATGG + Intronic
1189800215 X:44685010-44685032 CTTCATCTTCAAACCAGCAATGG - Intergenic
1192265352 X:69533835-69533857 CCCCACCTTCAGGCCAGCAAGGG - Intergenic
1193758167 X:85434331-85434353 CTCCATCTTCAGGCCAGCAATGG + Intergenic
1193848564 X:86506340-86506362 CTCCATCTTCAAACTGGTAGTGG + Intronic
1194075866 X:89393146-89393168 CTCCTTCTTCAAACCGGAAATGG - Intergenic
1194847077 X:98823016-98823038 CTCCAGCTTCAAGCCAGCAATGG - Intergenic
1195042715 X:101028812-101028834 CTCCATCACCAGAACAGCAAGGG - Intronic
1196185990 X:112745526-112745548 TTCCATCTTCAAGCCAGCAAGGG - Intergenic
1198012149 X:132568435-132568457 CTCCATCTCCAAACCAGCAATGG - Intergenic
1198508999 X:137330359-137330381 CTCCATCTTCAAAGCAGTAATGG + Intergenic
1199293946 X:146136239-146136261 CTCCATCTTCAGGCAGACAGTGG - Intergenic
1199432959 X:147781333-147781355 CTCTATCTTCAAGCCAGCAATGG + Intergenic
1200795848 Y:7340587-7340609 CTCCATCTTCAGGCAGGCCCAGG + Intergenic
1201625871 Y:16013509-16013531 CTCCATCATGAGAACGGCAAAGG - Intergenic