ID: 924503714

View in Genome Browser
Species Human (GRCh38)
Location 1:244660928-244660950
Sequence CTATTATTCCAAAGCTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924503711_924503714 -9 Left 924503711 1:244660914-244660936 CCAGTTTCCCTTTACTATTATTC 0: 1
1: 0
2: 1
3: 27
4: 391
Right 924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG 0: 1
1: 0
2: 3
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924503714 Original CRISPR CTATTATTCCAAAGCTTTAT TGG Intronic
906559562 1:46746255-46746277 CTATTATTCCATAGCATTATAGG - Intergenic
906765044 1:48422055-48422077 TCATTATTCCAAATCTGTATTGG - Intronic
909467575 1:75990498-75990520 CATTTATTCCAAAGCTTTCCTGG + Intergenic
909707049 1:78597822-78597844 CTATTATTCCAAAACCTCAGAGG + Intergenic
910172641 1:84394193-84394215 CTATTTTTGTAAAGTTTTATTGG - Intergenic
911432099 1:97802824-97802846 CTATTTTTCAAAAGTTCTATTGG + Intronic
911970073 1:104422696-104422718 CATTTATTGCAAAGCTTTCTAGG - Intergenic
913568708 1:120099205-120099227 CTGTTTTTCAAAAGCATTATTGG - Intergenic
914289523 1:146260226-146260248 CTGTTTTTCAAAAGCATTATTGG - Intergenic
914550559 1:148710979-148711001 CTGTTTTTCAAAAGCATTATTGG - Intergenic
914772252 1:150698460-150698482 CTTTTATTCAAAAGTTCTATTGG + Exonic
918125770 1:181582171-181582193 CTATTATGCTAAAGCTCTAAAGG + Intronic
918833134 1:189424615-189424637 CTAATTTTCTAAAGCTTGATAGG + Intergenic
919373938 1:196768259-196768281 ATGTTATGCCAAAGCTTAATGGG - Intergenic
919380383 1:196852943-196852965 TTGTTATGCCAAAGCTTAATGGG - Intronic
922246649 1:223805626-223805648 CCATTATTTCAAAGCCCTATTGG + Intronic
922679726 1:227583143-227583165 CTATTATTTCTAAGTTCTATTGG + Intronic
923118403 1:230966253-230966275 ATTTTATTCCAAAACTTTCTTGG + Intronic
924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG + Intronic
924874036 1:248081455-248081477 TTATTCTTCCAAAATTTTATAGG + Intronic
1064591446 10:16896192-16896214 ATATGATTCACAAGCTTTATGGG + Intronic
1066390172 10:34971977-34971999 CTATAATTCCAAAAGTTTTTAGG - Intergenic
1066451569 10:35534574-35534596 CTATTTTTTAATAGCTTTATTGG + Intronic
1067579889 10:47437339-47437361 CAATTATGCAATAGCTTTATAGG + Intergenic
1067894399 10:50163392-50163414 CTCTTATTCCAAAGTATTATGGG - Intergenic
1067954444 10:50776869-50776891 CTCTTATTCCAAAGTATTATGGG + Intronic
1068107826 10:52641907-52641929 CTATTTTACCAAAAGTTTATGGG + Intergenic
1068294385 10:55050618-55050640 TATTTATTCCAAAGCTGTATTGG + Intronic
1068894744 10:62186991-62187013 CATTTAGTCCAAAGCTTTCTGGG + Intronic
1069159524 10:65076261-65076283 CTTTTCTTCCTAAGTTTTATTGG + Intergenic
1071073299 10:81720839-81720861 CAATTATTCTAAAGCTTATTTGG + Intergenic
1074725910 10:116309555-116309577 CTCTTTTTCCCCAGCTTTATTGG - Intergenic
1075695401 10:124431103-124431125 CTATTTTTCCATAACTTTTTTGG - Intergenic
1078607252 11:12787410-12787432 CTCTTTCTCCAAAGCTTAATAGG - Intronic
1080109995 11:28556050-28556072 TTATTATTCCACAGATTTCTAGG + Intergenic
1080138768 11:28890315-28890337 CTATTTTTGTAAAGTTTTATTGG + Intergenic
1083007665 11:59363500-59363522 AACTTATTCCAAAACTTTATTGG + Intergenic
1083909644 11:65698760-65698782 TTATTCTTCCAAATCTTTTTGGG - Intergenic
1084240118 11:67813631-67813653 CTATAATTTCAGAGCTTTGTGGG - Intergenic
1084832324 11:71779204-71779226 CTATAATTCCAGAGCTTTGTGGG + Intergenic
1085910586 11:80820348-80820370 CTTTAACTCCAAAGCTTTGTTGG - Intergenic
1085991158 11:81846311-81846333 CTATTATTCAATAGCATAATAGG + Intergenic
1087068251 11:94047811-94047833 CAGTGATTCTAAAGCTTTATAGG + Intronic
1087965081 11:104403123-104403145 TTTTTATTCCAAAGCTTGCTAGG + Intergenic
1088479014 11:110275425-110275447 GTATTATCCCACAGTTTTATAGG - Intronic
1088617857 11:111650092-111650114 CTACTAATCCAATGTTTTATGGG - Intronic
1088845707 11:113664530-113664552 CCATTATTCTAAATCTTTACTGG + Intergenic
1089972642 11:122706444-122706466 CTATTTCTCCAGACCTTTATGGG - Intronic
1090052553 11:123392524-123392546 CCATAATTCCATAGCTTTATAGG - Intergenic
1090634393 11:128681468-128681490 ATATTATTCCACAGTTGTATTGG + Intergenic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1092410360 12:8248185-8248207 CTATAATTCCAGAGCTTTGTGGG - Intergenic
1093212389 12:16323675-16323697 ACATTACTCCAAAGCTATATGGG - Intergenic
1093390589 12:18614974-18614996 TTATTATTTCAATGCTTTTTAGG + Intronic
1094678059 12:32640716-32640738 ACATTATTTCAAAACTTTATCGG - Exonic
1096673222 12:53212282-53212304 CTATCATTGCAAAGTTCTATTGG - Intronic
1097312274 12:58133163-58133185 CTATTATTACTAAGCTATGTGGG + Intergenic
1098528381 12:71512548-71512570 CTTTTATTTCAAAGCTGTACAGG + Intronic
1098708130 12:73717846-73717868 CTATCATTTTAAAGCTTTAAAGG - Intergenic
1101090177 12:101277069-101277091 CTTTTATTCTTAAGCTTTATAGG - Intergenic
1104110543 12:125700409-125700431 CTATTTTTCCAAAGCTACATAGG + Intergenic
1107167875 13:37304096-37304118 TTATTTTTCCAAACCTTTAGTGG + Intergenic
1107427277 13:40306608-40306630 CAATTAGTCCTAAGCATTATGGG + Intergenic
1107557806 13:41533073-41533095 CTTTTATTCTAAAGATGTATTGG - Intergenic
1107640564 13:42438972-42438994 TTATTATTTCACAGTTTTATAGG - Intergenic
1107727337 13:43312272-43312294 CTCTTATTTTAAAGCTATATTGG + Intronic
1109478307 13:62914585-62914607 CTACTGTTCCAAAGGGTTATAGG + Intergenic
1111789515 13:92836838-92836860 CTGTTATTCCAAATCTCTTTTGG + Intronic
1116017706 14:39427222-39427244 TTTTTATTCCACAGCTGTATTGG - Intronic
1117050295 14:51853777-51853799 CTATTTTTCCAAGGCTTTGTGGG + Intronic
1117782574 14:59249252-59249274 GTATTTTCCCAAAGCTTCATAGG + Intronic
1119607269 14:76031174-76031196 CTATTTTTATAAAGTTTTATTGG + Intronic
1119934364 14:78577335-78577357 ATATTATTCCAAAGATGTATGGG + Intronic
1119980732 14:79078009-79078031 TTATTTTTTGAAAGCTTTATTGG - Intronic
1122170814 14:99873319-99873341 CTATTTTTCCAAAGGACTATTGG - Intronic
1127528935 15:59823007-59823029 TTATTATCTCAAAGTTTTATAGG + Intergenic
1127736908 15:61849675-61849697 CTGTTCTTACAAAGTTTTATTGG - Intergenic
1132716103 16:1290609-1290631 CGATTATTAAAAAGCTTTAGAGG + Intergenic
1133351574 16:5104368-5104390 CTATAATTCCAGAGCTTTGTGGG - Intergenic
1133404459 16:5511923-5511945 CTATTAATCCACAGCTTCAGAGG + Intergenic
1134480379 16:14614007-14614029 CTATAATCCCAGAGCTTTAGGGG + Intronic
1144116867 17:12103302-12103324 CTGTAATTCCAATGCTTTAGGGG - Intronic
1146336962 17:31981070-31981092 CCAATATTCAAAAGCCTTATAGG + Intronic
1150109031 17:62481877-62481899 ATTTTATTTAAAAGCTTTATTGG + Intronic
1150333817 17:64315503-64315525 TTATTTTTCCAAGGATTTATTGG - Intergenic
1153388020 18:4521635-4521657 CTAATGTCACAAAGCTTTATTGG + Intergenic
1156061799 18:33086252-33086274 AAATTATTCTATAGCTTTATAGG + Intronic
1157780345 18:50432842-50432864 CCAATATTCCAAAGGTTTACAGG - Intergenic
1163350213 19:16772106-16772128 CTATAATTCCAGAGCTTTGAGGG + Intronic
1164094457 19:21994013-21994035 CAATAATTCCAAGGCTTTAAAGG + Intronic
1164114049 19:22199558-22199580 CAATAATTCCAAGGCTTTAAAGG + Intergenic
1165868073 19:38951089-38951111 CTGTTTTTTCAAAGATTTATAGG + Intronic
925570611 2:5308496-5308518 CTATTATATCAAATCTTAATGGG + Intergenic
926529095 2:14019890-14019912 ATATTCTTTCAAACCTTTATGGG + Intergenic
929292669 2:40211269-40211291 CTATCATTAGAAAACTTTATAGG - Intronic
930560764 2:52957451-52957473 CTATTATTTCACAGTTCTATAGG - Intergenic
931215920 2:60244561-60244583 ATATTTTTCCAAAACTATATAGG - Intergenic
931280241 2:60784711-60784733 CTATTTTTATAAAGTTTTATTGG + Intronic
931473935 2:62569243-62569265 CTTTTTTTCCAAAGCTTTCCAGG + Intergenic
931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG + Intronic
933790413 2:85879524-85879546 CTATTATGTAAAAGCTTGATGGG - Intronic
934172962 2:89555454-89555476 CTATTTTTATAAAGTTTTATTGG - Intergenic
934283276 2:91629811-91629833 CTATTTTTATAAAGTTTTATTGG - Intergenic
934865109 2:97801635-97801657 TTATTATTACAAACCTTCATGGG + Intronic
936755515 2:115705477-115705499 CTATTATACCAGAGCTTTAATGG + Intronic
939442219 2:142263850-142263872 CCTTTATTCCAGAGCTTCATTGG - Intergenic
939603049 2:144217779-144217801 CTTCTACTCCAAACCTTTATTGG - Intronic
939889713 2:147722050-147722072 CTATTATACAAAAACTTTCTTGG - Intergenic
940838463 2:158551996-158552018 ATCTTATTTCAAAACTTTATGGG + Intronic
941579674 2:167279427-167279449 CTTTTATTTCAATGCTTTTTTGG - Intergenic
942567175 2:177278503-177278525 CTATTTATCCAAAGCTTGTTTGG + Intronic
944783548 2:203044424-203044446 CTAATATTCCAAACATTTAAAGG - Intronic
945236942 2:207639799-207639821 TTATTATTTTAGAGCTTTATTGG + Intergenic
947314583 2:228841977-228841999 CAATTATTACAAAGCTTTCCTGG - Intergenic
947594751 2:231403959-231403981 CTATCATTCCAAAGGTTCTTAGG - Intergenic
1168898475 20:1340106-1340128 CTATAATTGCAATGCATTATGGG - Intronic
1169595483 20:7193703-7193725 CTTTGAAACCAAAGCTTTATAGG + Intergenic
1170528979 20:17270379-17270401 CAGTAATTTCAAAGCTTTATGGG + Intronic
1173020423 20:39263003-39263025 CTATTGTTCCATAGCTCTGTAGG + Intergenic
1174994245 20:55547566-55547588 CTATTTTTATAAATCTTTATTGG + Intergenic
1175734886 20:61378292-61378314 CTATAATTTCAAAGTTTTAAAGG - Intronic
1175885012 20:62284973-62284995 TGAGTATTCCAAAGCTTTAAGGG - Intronic
1180849048 22:19002800-19002822 CTACTATTCTAAAGCTTCAACGG - Intergenic
1183052048 22:35270905-35270927 ATATTTTTAAAAAGCTTTATAGG - Intronic
1183206653 22:36424061-36424083 TTATTATTCCAAAGGCTTCTGGG + Intergenic
949601192 3:5599672-5599694 CTATTTTTCTAAAGCTCTCTAGG + Intergenic
950928995 3:16770627-16770649 GTTTTTTTTCAAAGCTTTATAGG + Intergenic
951337386 3:21441120-21441142 TTATTATTTCAAGTCTTTATGGG - Intronic
951599127 3:24353729-24353751 TTATTAATACAAAGTTTTATAGG - Intronic
951698191 3:25467734-25467756 CTATTATTCCCTAGTTTGATGGG + Intronic
952047305 3:29338426-29338448 CTACTATTCTAAACCTTTACAGG - Intronic
954009874 3:47626580-47626602 CAATTATTCCAAAGATGCATTGG - Intronic
954592577 3:51795968-51795990 CTATTTTTTCATTGCTTTATGGG + Intergenic
955331994 3:58054843-58054865 CTATTTTTATAAAGTTTTATTGG + Intronic
956573401 3:70723268-70723290 CTATTCTTGTAAAGTTTTATGGG + Intergenic
956620033 3:71212673-71212695 ATATCATTCAAATGCTTTATTGG + Intronic
957055595 3:75440301-75440323 CTATAATTCCAGAGCTTTGTGGG - Intergenic
958456541 3:94338735-94338757 TTTTTATTCCAAAGTTTCATGGG + Intergenic
960185809 3:114637254-114637276 TTATTTTTCCAAAGCTTTCCTGG + Intronic
960666300 3:120112225-120112247 CTGTTACTCCAAAGCCTTATAGG - Intergenic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
961298794 3:125908302-125908324 CTATAATTCCAGAGCTTTGTGGG + Intergenic
961889264 3:130116683-130116705 CTATAATTCCAGAGCTTTGTGGG - Intergenic
962176124 3:133157304-133157326 CTATTTTTCAAAAGTTTAATTGG + Intronic
963307642 3:143670928-143670950 ATTTTCTTCCAAAGCTTGATTGG + Intronic
964280795 3:155062345-155062367 ATATTTTTTCAAAGCTTTAAAGG + Intronic
964995509 3:162874400-162874422 CTATTATTTGAAAGCAATATAGG - Intergenic
967670575 3:192229753-192229775 ATAATGTTCCAAAGCTGTATAGG - Intronic
967946375 3:194807354-194807376 GTAATTTTCCAAAGCTTTAGAGG + Intergenic
968338801 3:197937104-197937126 CTGTTTTTGAAAAGCTTTATTGG - Intronic
969815487 4:9684174-9684196 CTATAATTCCAGAGCTTTGTGGG + Intergenic
971626133 4:28922337-28922359 TTTTGATTCCAAAGCTTAATTGG + Intergenic
973024512 4:45250701-45250723 ATATTGTTCCAAACATTTATTGG - Intergenic
975445842 4:74464151-74464173 CTATTATTCCAATCCTTTGTGGG + Intergenic
975810570 4:78164324-78164346 TTATTACTCCAAAGCATTATGGG - Intronic
976143391 4:82016867-82016889 TTATTTTTAAAAAGCTTTATTGG - Intronic
976365945 4:84232342-84232364 CTTTAATTCCAAATTTTTATCGG + Intergenic
976434409 4:85000677-85000699 TTTTTATTCGAAAGGTTTATGGG + Intergenic
978634277 4:110785385-110785407 CTATTCTTCTGAATCTTTATGGG + Intergenic
978873097 4:113604429-113604451 CAATTTTTCTAATGCTTTATTGG + Intronic
978955857 4:114612427-114612449 CTATTTTTCCAAAGCTTCCCAGG + Intronic
979767941 4:124484884-124484906 CTACTATACAAGAGCTTTATAGG - Intergenic
980337308 4:131493688-131493710 TGATTATTCTAATGCTTTATGGG + Intergenic
981932788 4:150208801-150208823 TTATTGTACTAAAGCTTTATGGG - Intronic
982211771 4:153042934-153042956 CTATTGCTCCAAAGCTATAAAGG - Intergenic
983685859 4:170408116-170408138 CTATTATTCCTAGGATTTTTAGG + Intergenic
983786251 4:171733235-171733257 TTATTATTCCAGAGCTTTATTGG - Intergenic
983820161 4:172183224-172183246 CTTTTATTCCAAAGTTTAAAAGG + Intronic
984068181 4:175076547-175076569 TTATTTTCCCAAAGTTTTATAGG - Intergenic
984355380 4:178652381-178652403 CTATAATTCCCACGCTTTGTAGG + Intergenic
986152796 5:5142708-5142730 CTATTATTGCAAATCATTCTTGG + Intronic
988436901 5:31186800-31186822 CTATTATTCCAAATCCATAATGG + Intergenic
988459793 5:31424266-31424288 CTATTGTTCCAAAGTTTTCCAGG + Intronic
989340896 5:40374500-40374522 CTATAATTCCATAGCTCTATAGG - Intergenic
989718880 5:44500923-44500945 ATGTTATTTTAAAGCTTTATTGG + Intergenic
990354741 5:54955341-54955363 GTAGGATTCCAAAGCTTTCTTGG + Intergenic
991222760 5:64235571-64235593 CTACAATTCCAAAGTTTTCTAGG + Intronic
992172770 5:74120829-74120851 CTCTTATCCCAAAGCTATCTAGG - Intergenic
992304014 5:75416731-75416753 CTACTACTCTGAAGCTTTATGGG - Intronic
992521859 5:77561514-77561536 CTATTATTAGAAATCTTCATTGG + Intronic
993859957 5:93124228-93124250 CTTTTATTCTAATTCTTTATAGG + Intergenic
993996520 5:94729828-94729850 ATTTTATTCCAAAGCATGATGGG + Intronic
994307563 5:98225159-98225181 CTCTTATTCCAAAGCCTTCAAGG + Intergenic
995170460 5:109105050-109105072 ATATTATTCTTAAGCTTCATTGG + Intronic
995202386 5:109441066-109441088 CTAATATTCTAAAACTTTTTTGG + Intergenic
996248482 5:121295980-121296002 CAATTATTCTAAAGTTTTTTAGG - Intergenic
996572087 5:124942856-124942878 CTACTATTCTTAAGCTTTAGAGG + Intergenic
997756615 5:136405756-136405778 CAAATTTTCCAAAGTTTTATGGG - Intergenic
999019433 5:148147234-148147256 TTATGGTCCCAAAGCTTTATAGG - Intergenic
1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG + Intergenic
1000267179 5:159648583-159648605 CTATTTTTGTAAAGTTTTATTGG + Intergenic
1000470051 5:161629888-161629910 TTATTCTTCCACAGCTTTGTTGG - Intronic
1001657682 5:173364948-173364970 CTATTTTTAGAAAGTTTTATTGG + Intergenic
1005632889 6:27725263-27725285 CTGTTTTTATAAAGCTTTATTGG - Intergenic
1007558392 6:42784902-42784924 CTAGTATTCCAAAGCTCTCCAGG + Intronic
1008604362 6:53125612-53125634 CTGTTGGTCCAAAGCTTTCTGGG - Intergenic
1009779263 6:68248382-68248404 CTATTATTCAAAGTCATTATGGG - Intergenic
1010703637 6:79080035-79080057 CTATTATTCCAAAGGGTTTGAGG - Intergenic
1011469984 6:87699136-87699158 CGATTATTCTTAAACTTTATGGG - Intronic
1012378855 6:98595671-98595693 CTATTTCTACAAAGTTTTATAGG - Intergenic
1013358541 6:109371004-109371026 CTGTTCTTATAAAGCTTTATTGG - Intronic
1013916959 6:115352157-115352179 CTTTTATTCCACATCTTTATGGG - Intergenic
1014181922 6:118394130-118394152 ATATTATTTCAAATCTTTTTTGG - Intergenic
1014397016 6:120936716-120936738 CTAATCTTCCTAATCTTTATGGG + Intergenic
1014797444 6:125742362-125742384 CTATTGTTCTTAAACTTTATAGG - Intergenic
1015001109 6:128216946-128216968 CTGTTATTCAAAAGCATTCTAGG + Intronic
1015437883 6:133210930-133210952 CAATTATTCCACAACTTTACTGG + Intergenic
1016611013 6:145989611-145989633 CTATTTTACCAAAGGGTTATTGG - Intergenic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1017559474 6:155611268-155611290 CTATAATTCCCAAGTGTTATGGG + Intergenic
1020670324 7:11098694-11098716 CCATTATTCCAAGGCTGTCTTGG + Intronic
1020930910 7:14392841-14392863 TTCTTATTCCAAAGCTATCTTGG - Intronic
1023104861 7:36753751-36753773 CTATTATGCCGAAGCTATTTTGG - Intergenic
1023260306 7:38351799-38351821 GTATTATTTCACAACTTTATAGG - Intergenic
1026778332 7:73246176-73246198 CTGTTATTACAAAGTTTTCTTGG - Intergenic
1027019187 7:74799565-74799587 CTGTTATTACAAAGTTTTCTTGG - Intronic
1027035858 7:74924815-74924837 CTATTTTTCCAGAGCCTAATTGG + Intergenic
1027068840 7:75146374-75146396 CTGTTATTACAAAGTTTTCTTGG + Intronic
1027479177 7:78672958-78672980 CATTTATTCCAAACTTTTATAGG - Intronic
1027784587 7:82565145-82565167 GTATTTTTCAAAAGTTTTATAGG - Intergenic
1029010554 7:97257462-97257484 TTAATATTCCAATGCTTTTTGGG + Intergenic
1031074698 7:117201219-117201241 ATTTTGTTCCAAAGCTTTTTTGG + Intronic
1031096677 7:117428394-117428416 CTATTATTTGAAAGCTTTTGCGG + Intergenic
1033386045 7:140876108-140876130 CTATTAATTGAAAGCTTCATTGG - Intronic
1033522044 7:142170357-142170379 CTATTTTTCCCATGCTTTAATGG + Intronic
1033895070 7:146058604-146058626 CTATGATTGCAATGCATTATGGG - Intergenic
1035142379 7:156775811-156775833 CTATTTTTTAAAAGCTTTTTTGG - Intronic
1035488431 7:159250562-159250584 TAATTATTCCACAGCTTTGTTGG - Intergenic
1036378842 8:8223353-8223375 CTATAACTCCAGAGCTTTGTGGG + Intergenic
1036850723 8:12199253-12199275 CTATAATTTCAGAGCTTTGTGGG - Intergenic
1036872088 8:12441518-12441540 CTATAATTTCAGAGCTTTGTGGG - Intergenic
1038798877 8:30731814-30731836 CTATAATTCCAAAGGTTCTTAGG - Intergenic
1038999880 8:32967962-32967984 CTCTTGTGCCAAAGTTTTATAGG - Intergenic
1039285441 8:36034940-36034962 CTATTATTTTACAGCTCTATAGG - Intergenic
1043843856 8:85141984-85142006 GTATTATTAAAAAGCTTCATAGG - Intronic
1045829393 8:106440230-106440252 CTATTAGACCATAGCTTTTTGGG - Intronic
1046266180 8:111833525-111833547 CTTTTATACCAAAGCTTAAATGG - Intergenic
1046815325 8:118576958-118576980 CTATGTTTACATAGCTTTATAGG - Intronic
1047480658 8:125279151-125279173 CTCTTATTACAAAGCTATGTCGG + Intronic
1050669775 9:7982838-7982860 CTATTGTTTAAAAACTTTATAGG + Intergenic
1052511828 9:29432039-29432061 TTATTATTTAAAACCTTTATGGG + Intergenic
1056653008 9:88484849-88484871 CTATTATTCCATAAATTCATAGG + Intergenic
1056682816 9:88733991-88734013 CTAGTATTGCCAAGTTTTATTGG + Intergenic
1056787064 9:89600912-89600934 CTATCATTCAAGAGCTTTTTTGG + Intergenic
1058622167 9:106895132-106895154 ATAATATTCCATACCTTTATTGG + Intronic
1059296046 9:113271646-113271668 TTATTATTTCACAGTTTTATAGG - Intronic
1060329886 9:122658022-122658044 CTATTGTTGCAAACCTTTCTGGG + Intergenic
1186240973 X:7566005-7566027 CAATTTTTCAAACGCTTTATTGG + Intergenic
1187090588 X:16092049-16092071 CTATTATAGCAAAACATTATGGG - Intergenic
1188126123 X:26371766-26371788 GTATTATTTAAAATCTTTATAGG + Intergenic
1188290797 X:28385948-28385970 TTATTTTTCCAAATCTGTATTGG - Intergenic
1188530020 X:31129651-31129673 CTGTTTTTATAAAGCTTTATTGG - Intronic
1189425213 X:40894574-40894596 CTTGTTTTTCAAAGCTTTATTGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1192603448 X:72488800-72488822 CCAGTATACAAAAGCTTTATAGG + Intronic
1194020091 X:88678271-88678293 CTATTCTTTCAAACTTTTATAGG - Intergenic
1194400310 X:93432899-93432921 CTATAATTCCAAAGGTTCTTAGG - Intergenic
1194500101 X:94672231-94672253 TTTTTATTTCACAGCTTTATAGG - Intergenic
1197923678 X:131623797-131623819 TTATTATTCCAAGACTTTTTGGG - Intergenic
1198299448 X:135320785-135320807 CAATTCTTCCAATGCATTATGGG + Intronic
1199656826 X:150004603-150004625 ATGTTATTCCAAAGATTTATGGG - Intergenic
1201376633 Y:13330129-13330151 CTAGTGTTACAAACCTTTATTGG - Intronic