ID: 924511683

View in Genome Browser
Species Human (GRCh38)
Location 1:244733073-244733095
Sequence GCTCCTGAGAACTTACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924511683_924511689 19 Left 924511683 1:244733073-244733095 CCTGCCAGTAAGTTCTCAGGAGC No data
Right 924511689 1:244733115-244733137 ATGTGCACTAAGAGGCAAAGCGG No data
924511683_924511690 22 Left 924511683 1:244733073-244733095 CCTGCCAGTAAGTTCTCAGGAGC No data
Right 924511690 1:244733118-244733140 TGCACTAAGAGGCAAAGCGGCGG No data
924511683_924511688 11 Left 924511683 1:244733073-244733095 CCTGCCAGTAAGTTCTCAGGAGC No data
Right 924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924511683 Original CRISPR GCTCCTGAGAACTTACTGGC AGG (reversed) Intergenic
No off target data available for this crispr