ID: 924511685

View in Genome Browser
Species Human (GRCh38)
Location 1:244733077-244733099
Sequence CCCAGCTCCTGAGAACTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924511685_924511688 7 Left 924511685 1:244733077-244733099 CCAGTAAGTTCTCAGGAGCTGGG No data
Right 924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG No data
924511685_924511689 15 Left 924511685 1:244733077-244733099 CCAGTAAGTTCTCAGGAGCTGGG No data
Right 924511689 1:244733115-244733137 ATGTGCACTAAGAGGCAAAGCGG No data
924511685_924511691 29 Left 924511685 1:244733077-244733099 CCAGTAAGTTCTCAGGAGCTGGG No data
Right 924511691 1:244733129-244733151 GCAAAGCGGCGGAGTTTAACTGG No data
924511685_924511690 18 Left 924511685 1:244733077-244733099 CCAGTAAGTTCTCAGGAGCTGGG No data
Right 924511690 1:244733118-244733140 TGCACTAAGAGGCAAAGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924511685 Original CRISPR CCCAGCTCCTGAGAACTTAC TGG (reversed) Intergenic
No off target data available for this crispr