ID: 924511688

View in Genome Browser
Species Human (GRCh38)
Location 1:244733107-244733129
Sequence GCTCAAGTATGTGCACTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924511683_924511688 11 Left 924511683 1:244733073-244733095 CCTGCCAGTAAGTTCTCAGGAGC No data
Right 924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG No data
924511685_924511688 7 Left 924511685 1:244733077-244733099 CCAGTAAGTTCTCAGGAGCTGGG No data
Right 924511688 1:244733107-244733129 GCTCAAGTATGTGCACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924511688 Original CRISPR GCTCAAGTATGTGCACTAAG AGG Intergenic
No off target data available for this crispr