ID: 924511689

View in Genome Browser
Species Human (GRCh38)
Location 1:244733115-244733137
Sequence ATGTGCACTAAGAGGCAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924511683_924511689 19 Left 924511683 1:244733073-244733095 CCTGCCAGTAAGTTCTCAGGAGC No data
Right 924511689 1:244733115-244733137 ATGTGCACTAAGAGGCAAAGCGG No data
924511685_924511689 15 Left 924511685 1:244733077-244733099 CCAGTAAGTTCTCAGGAGCTGGG No data
Right 924511689 1:244733115-244733137 ATGTGCACTAAGAGGCAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924511689 Original CRISPR ATGTGCACTAAGAGGCAAAG CGG Intergenic
No off target data available for this crispr