ID: 924511691

View in Genome Browser
Species Human (GRCh38)
Location 1:244733129-244733151
Sequence GCAAAGCGGCGGAGTTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924511685_924511691 29 Left 924511685 1:244733077-244733099 CCAGTAAGTTCTCAGGAGCTGGG No data
Right 924511691 1:244733129-244733151 GCAAAGCGGCGGAGTTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924511691 Original CRISPR GCAAAGCGGCGGAGTTTAAC TGG Intergenic
No off target data available for this crispr