ID: 924514829

View in Genome Browser
Species Human (GRCh38)
Location 1:244757211-244757233
Sequence CAGCTGTCCTTGGACTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924514829_924514835 27 Left 924514829 1:244757211-244757233 CCAGTCTAGTCCAAGGACAGCTG No data
Right 924514835 1:244757261-244757283 CTACGGCACAGCAAACCAGGCGG No data
924514829_924514832 -7 Left 924514829 1:244757211-244757233 CCAGTCTAGTCCAAGGACAGCTG No data
Right 924514832 1:244757227-244757249 ACAGCTGTGAAGCTCTTGGTTGG No data
924514829_924514834 24 Left 924514829 1:244757211-244757233 CCAGTCTAGTCCAAGGACAGCTG No data
Right 924514834 1:244757258-244757280 TGACTACGGCACAGCAAACCAGG No data
924514829_924514836 30 Left 924514829 1:244757211-244757233 CCAGTCTAGTCCAAGGACAGCTG No data
Right 924514836 1:244757264-244757286 CGGCACAGCAAACCAGGCGGCGG No data
924514829_924514833 10 Left 924514829 1:244757211-244757233 CCAGTCTAGTCCAAGGACAGCTG No data
Right 924514833 1:244757244-244757266 GGTTGGTATAGCTGTGACTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924514829 Original CRISPR CAGCTGTCCTTGGACTAGAC TGG (reversed) Intergenic
No off target data available for this crispr