ID: 924516320

View in Genome Browser
Species Human (GRCh38)
Location 1:244769012-244769034
Sequence GAGGGAGAGCGCAGTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516320_924516330 13 Left 924516320 1:244769012-244769034 CCCCAGTCACTGCGCTCTCCCTC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516320_924516331 24 Left 924516320 1:244769012-244769034 CCCCAGTCACTGCGCTCTCCCTC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516320_924516323 -8 Left 924516320 1:244769012-244769034 CCCCAGTCACTGCGCTCTCCCTC No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516320 Original CRISPR GAGGGAGAGCGCAGTGACTG GGG (reversed) Intergenic
No off target data available for this crispr