ID: 924516321

View in Genome Browser
Species Human (GRCh38)
Location 1:244769013-244769035
Sequence GGAGGGAGAGCGCAGTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516321_924516330 12 Left 924516321 1:244769013-244769035 CCCAGTCACTGCGCTCTCCCTCC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516321_924516331 23 Left 924516321 1:244769013-244769035 CCCAGTCACTGCGCTCTCCCTCC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516321_924516323 -9 Left 924516321 1:244769013-244769035 CCCAGTCACTGCGCTCTCCCTCC No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data
924516321_924516333 30 Left 924516321 1:244769013-244769035 CCCAGTCACTGCGCTCTCCCTCC No data
Right 924516333 1:244769066-244769088 CACGGCCACTGTTAGGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516321 Original CRISPR GGAGGGAGAGCGCAGTGACT GGG (reversed) Intergenic
No off target data available for this crispr