ID: 924516322

View in Genome Browser
Species Human (GRCh38)
Location 1:244769014-244769036
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516322_924516330 11 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516322_924516333 29 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516333 1:244769066-244769088 CACGGCCACTGTTAGGAGATTGG No data
924516322_924516331 22 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516322_924516323 -10 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data
924516322_924516334 30 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516322 Original CRISPR GGGAGGGAGAGCGCAGTGAC TGG (reversed) Intergenic