ID: 924516323

View in Genome Browser
Species Human (GRCh38)
Location 1:244769027-244769049
Sequence TCTCCCTCCCCCAAGCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516322_924516323 -10 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data
924516318_924516323 5 Left 924516318 1:244768999-244769021 CCAATGCAAAGTCCCCCAGTCAC No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data
924516321_924516323 -9 Left 924516321 1:244769013-244769035 CCCAGTCACTGCGCTCTCCCTCC No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data
924516319_924516323 -7 Left 924516319 1:244769011-244769033 CCCCCAGTCACTGCGCTCTCCCT No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data
924516320_924516323 -8 Left 924516320 1:244769012-244769034 CCCCAGTCACTGCGCTCTCCCTC No data
Right 924516323 1:244769027-244769049 TCTCCCTCCCCCAAGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516323 Original CRISPR TCTCCCTCCCCCAAGCACAC AGG Intergenic