ID: 924516324

View in Genome Browser
Species Human (GRCh38)
Location 1:244769030-244769052
Sequence GAACCTGTGTGCTTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516324_924516331 6 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516324_924516334 14 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516324_924516333 13 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516333 1:244769066-244769088 CACGGCCACTGTTAGGAGATTGG No data
924516324_924516330 -5 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516324_924516335 15 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516335 1:244769068-244769090 CGGCCACTGTTAGGAGATTGGGG No data
924516324_924516337 18 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516324_924516339 20 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516339 1:244769073-244769095 ACTGTTAGGAGATTGGGGAGGGG No data
924516324_924516338 19 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516338 1:244769072-244769094 CACTGTTAGGAGATTGGGGAGGG No data
924516324_924516340 23 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516340 1:244769076-244769098 GTTAGGAGATTGGGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516324 Original CRISPR GAACCTGTGTGCTTGGGGGA GGG (reversed) Intergenic