ID: 924516325

View in Genome Browser
Species Human (GRCh38)
Location 1:244769031-244769053
Sequence AGAACCTGTGTGCTTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516325_924516339 19 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516339 1:244769073-244769095 ACTGTTAGGAGATTGGGGAGGGG No data
924516325_924516337 17 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516325_924516330 -6 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516325_924516340 22 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516340 1:244769076-244769098 GTTAGGAGATTGGGGAGGGGTGG No data
924516325_924516334 13 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516325_924516333 12 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516333 1:244769066-244769088 CACGGCCACTGTTAGGAGATTGG No data
924516325_924516331 5 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516325_924516338 18 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516338 1:244769072-244769094 CACTGTTAGGAGATTGGGGAGGG No data
924516325_924516335 14 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516335 1:244769068-244769090 CGGCCACTGTTAGGAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516325 Original CRISPR AGAACCTGTGTGCTTGGGGG AGG (reversed) Intergenic
No off target data available for this crispr