ID: 924516327

View in Genome Browser
Species Human (GRCh38)
Location 1:244769035-244769057
Sequence AAAGAGAACCTGTGTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 5, 2: 52, 3: 133, 4: 473}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516327_924516330 -10 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516327_924516339 15 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516339 1:244769073-244769095 ACTGTTAGGAGATTGGGGAGGGG No data
924516327_924516334 9 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516327_924516340 18 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516340 1:244769076-244769098 GTTAGGAGATTGGGGAGGGGTGG No data
924516327_924516337 13 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516327_924516331 1 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516327_924516333 8 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516333 1:244769066-244769088 CACGGCCACTGTTAGGAGATTGG No data
924516327_924516338 14 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516338 1:244769072-244769094 CACTGTTAGGAGATTGGGGAGGG No data
924516327_924516335 10 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516335 1:244769068-244769090 CGGCCACTGTTAGGAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516327 Original CRISPR AAAGAGAACCTGTGTGCTTG GGG (reversed) Intergenic