ID: 924516328

View in Genome Browser
Species Human (GRCh38)
Location 1:244769036-244769058
Sequence AAAAGAGAACCTGTGTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516328_924516334 8 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516328_924516340 17 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516340 1:244769076-244769098 GTTAGGAGATTGGGGAGGGGTGG No data
924516328_924516331 0 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516328_924516338 13 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516338 1:244769072-244769094 CACTGTTAGGAGATTGGGGAGGG No data
924516328_924516333 7 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516333 1:244769066-244769088 CACGGCCACTGTTAGGAGATTGG No data
924516328_924516335 9 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516335 1:244769068-244769090 CGGCCACTGTTAGGAGATTGGGG No data
924516328_924516339 14 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516339 1:244769073-244769095 ACTGTTAGGAGATTGGGGAGGGG No data
924516328_924516337 12 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516328 Original CRISPR AAAAGAGAACCTGTGTGCTT GGG (reversed) Intergenic