ID: 924516330

View in Genome Browser
Species Human (GRCh38)
Location 1:244769048-244769070
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516324_924516330 -5 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516327_924516330 -10 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516320_924516330 13 Left 924516320 1:244769012-244769034 CCCCAGTCACTGCGCTCTCCCTC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516326_924516330 -9 Left 924516326 1:244769034-244769056 CCCCCAAGCACACAGGTTCTCTT No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516325_924516330 -6 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516321_924516330 12 Left 924516321 1:244769013-244769035 CCCAGTCACTGCGCTCTCCCTCC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516319_924516330 14 Left 924516319 1:244769011-244769033 CCCCCAGTCACTGCGCTCTCCCT No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516322_924516330 11 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data
924516318_924516330 26 Left 924516318 1:244768999-244769021 CCAATGCAAAGTCCCCCAGTCAC No data
Right 924516330 1:244769048-244769070 GGTTCTCTTTTTGTGCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type