ID: 924516331

View in Genome Browser
Species Human (GRCh38)
Location 1:244769059-244769081
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516322_924516331 22 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516319_924516331 25 Left 924516319 1:244769011-244769033 CCCCCAGTCACTGCGCTCTCCCT No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516328_924516331 0 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516325_924516331 5 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516320_924516331 24 Left 924516320 1:244769012-244769034 CCCCAGTCACTGCGCTCTCCCTC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516329_924516331 -1 Left 924516329 1:244769037-244769059 CCAAGCACACAGGTTCTCTTTTT No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516326_924516331 2 Left 924516326 1:244769034-244769056 CCCCCAAGCACACAGGTTCTCTT No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516324_924516331 6 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516321_924516331 23 Left 924516321 1:244769013-244769035 CCCAGTCACTGCGCTCTCCCTCC No data
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data
924516327_924516331 1 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516331 1:244769059-244769081 TGTGCCTCACGGCCACTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type