ID: 924516332

View in Genome Browser
Species Human (GRCh38)
Location 1:244769063-244769085
Sequence ATCTCCTAACAGTGGCCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516332_924516340 -10 Left 924516332 1:244769063-244769085 CCTCACGGCCACTGTTAGGAGAT No data
Right 924516340 1:244769076-244769098 GTTAGGAGATTGGGGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516332 Original CRISPR ATCTCCTAACAGTGGCCGTG AGG (reversed) Intergenic