ID: 924516334

View in Genome Browser
Species Human (GRCh38)
Location 1:244769067-244769089
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516327_924516334 9 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516322_924516334 30 Left 924516322 1:244769014-244769036 CCAGTCACTGCGCTCTCCCTCCC No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516326_924516334 10 Left 924516326 1:244769034-244769056 CCCCCAAGCACACAGGTTCTCTT No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516329_924516334 7 Left 924516329 1:244769037-244769059 CCAAGCACACAGGTTCTCTTTTT No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516328_924516334 8 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516325_924516334 13 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data
924516324_924516334 14 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516334 1:244769067-244769089 ACGGCCACTGTTAGGAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr