ID: 924516337

View in Genome Browser
Species Human (GRCh38)
Location 1:244769071-244769093
Sequence CCACTGTTAGGAGATTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924516325_924516337 17 Left 924516325 1:244769031-244769053 CCTCCCCCAAGCACACAGGTTCT No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516329_924516337 11 Left 924516329 1:244769037-244769059 CCAAGCACACAGGTTCTCTTTTT No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516327_924516337 13 Left 924516327 1:244769035-244769057 CCCCAAGCACACAGGTTCTCTTT 0: 1
1: 5
2: 52
3: 133
4: 473
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516326_924516337 14 Left 924516326 1:244769034-244769056 CCCCCAAGCACACAGGTTCTCTT No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516324_924516337 18 Left 924516324 1:244769030-244769052 CCCTCCCCCAAGCACACAGGTTC No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data
924516328_924516337 12 Left 924516328 1:244769036-244769058 CCCAAGCACACAGGTTCTCTTTT No data
Right 924516337 1:244769071-244769093 CCACTGTTAGGAGATTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924516337 Original CRISPR CCACTGTTAGGAGATTGGGG AGG Intergenic