ID: 924518027

View in Genome Browser
Species Human (GRCh38)
Location 1:244782268-244782290
Sequence GGGTGAGAGAATGCAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924518027_924518033 9 Left 924518027 1:244782268-244782290 CCTCAGTTTGCATTCTCTCACCC No data
Right 924518033 1:244782300-244782322 AGCTCATTAGGAAGTCTTGTTGG No data
924518027_924518029 -3 Left 924518027 1:244782268-244782290 CCTCAGTTTGCATTCTCTCACCC No data
Right 924518029 1:244782288-244782310 CCCCACACAGCCAGCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924518027 Original CRISPR GGGTGAGAGAATGCAAACTG AGG (reversed) Intergenic
No off target data available for this crispr