ID: 924523385

View in Genome Browser
Species Human (GRCh38)
Location 1:244824776-244824798
Sequence TATATGAAATATTTATTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924523385_924523389 6 Left 924523385 1:244824776-244824798 CCATTAAATAAATATTTCATATA No data
Right 924523389 1:244824805-244824827 CATGTATATGAAAAGGGAGGCGG No data
924523385_924523390 7 Left 924523385 1:244824776-244824798 CCATTAAATAAATATTTCATATA No data
Right 924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG No data
924523385_924523387 0 Left 924523385 1:244824776-244824798 CCATTAAATAAATATTTCATATA No data
Right 924523387 1:244824799-244824821 AAGATACATGTATATGAAAAGGG No data
924523385_924523386 -1 Left 924523385 1:244824776-244824798 CCATTAAATAAATATTTCATATA No data
Right 924523386 1:244824798-244824820 AAAGATACATGTATATGAAAAGG No data
924523385_924523388 3 Left 924523385 1:244824776-244824798 CCATTAAATAAATATTTCATATA No data
Right 924523388 1:244824802-244824824 ATACATGTATATGAAAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924523385 Original CRISPR TATATGAAATATTTATTTAA TGG (reversed) Intergenic
No off target data available for this crispr