ID: 924523390

View in Genome Browser
Species Human (GRCh38)
Location 1:244824806-244824828
Sequence ATGTATATGAAAAGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924523385_924523390 7 Left 924523385 1:244824776-244824798 CCATTAAATAAATATTTCATATA No data
Right 924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG No data
924523384_924523390 8 Left 924523384 1:244824775-244824797 CCCATTAAATAAATATTTCATAT No data
Right 924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG No data
924523383_924523390 24 Left 924523383 1:244824759-244824781 CCATAATTAATTGAAACCCATTA No data
Right 924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924523390 Original CRISPR ATGTATATGAAAAGGGAGGC GGG Intergenic
No off target data available for this crispr