ID: 924539928

View in Genome Browser
Species Human (GRCh38)
Location 1:244970825-244970847
Sequence TGCGCCGGAGGCGCCGGCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 403}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924539913_924539928 16 Left 924539913 1:244970786-244970808 CCCCTCCCTCGGAGGCCGGGCCT 0: 1
1: 0
2: 3
3: 17
4: 220
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539909_924539928 21 Left 924539909 1:244970781-244970803 CCTTCCCCCTCCCTCGGAGGCCG 0: 1
1: 0
2: 0
3: 22
4: 317
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539907_924539928 24 Left 924539907 1:244970778-244970800 CCTCCTTCCCCCTCCCTCGGAGG 0: 1
1: 0
2: 6
3: 42
4: 491
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539916_924539928 11 Left 924539916 1:244970791-244970813 CCCTCGGAGGCCGGGCCTTGCAT 0: 1
1: 0
2: 1
3: 5
4: 79
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539921_924539928 -4 Left 924539921 1:244970806-244970828 CCTTGCATCCTGCGCGGGCTGCG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539912_924539928 17 Left 924539912 1:244970785-244970807 CCCCCTCCCTCGGAGGCCGGGCC 0: 1
1: 0
2: 3
3: 29
4: 345
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539917_924539928 10 Left 924539917 1:244970792-244970814 CCTCGGAGGCCGGGCCTTGCATC 0: 1
1: 0
2: 1
3: 9
4: 88
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539905_924539928 28 Left 924539905 1:244970774-244970796 CCGTCCTCCTTCCCCCTCCCTCG 0: 1
1: 2
2: 58
3: 548
4: 3722
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539904_924539928 29 Left 924539904 1:244970773-244970795 CCCGTCCTCCTTCCCCCTCCCTC 0: 1
1: 3
2: 50
3: 502
4: 3492
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539919_924539928 1 Left 924539919 1:244970801-244970823 CCGGGCCTTGCATCCTGCGCGGG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539915_924539928 14 Left 924539915 1:244970788-244970810 CCTCCCTCGGAGGCCGGGCCTTG 0: 1
1: 0
2: 0
3: 20
4: 181
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539914_924539928 15 Left 924539914 1:244970787-244970809 CCCTCCCTCGGAGGCCGGGCCTT 0: 1
1: 0
2: 0
3: 8
4: 137
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403
924539903_924539928 30 Left 924539903 1:244970772-244970794 CCCCGTCCTCCTTCCCCCTCCCT 0: 1
1: 2
2: 46
3: 505
4: 3150
Right 924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924539928 Original CRISPR TGCGCCGGAGGCGCCGGCAG GGG Exonic
900249298 1:1658927-1658949 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
902350104 1:15847941-15847963 TGCGGCGGTGGCGTCGGCAGCGG - Exonic
903115511 1:21176227-21176249 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
903115630 1:21176579-21176601 GGCGGCGGAGGCGGCGGCGGCGG - Intronic
903263422 1:22143122-22143144 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
903652449 1:24930185-24930207 GGGGCGGGAGGCGGCGGCAGCGG - Intronic
903907453 1:26696653-26696675 GGCGGCGGCGGAGCCGGCAGCGG + Exonic
903925250 1:26826987-26827009 TGCGCCGTGGGCGGCGGCCGAGG - Exonic
904822953 1:33256829-33256851 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
905685181 1:39902369-39902391 TGCGCCCGAGCCGCCGCGAGGGG + Intergenic
906262526 1:44405396-44405418 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
907430050 1:54406358-54406380 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
909643102 1:77888600-77888622 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
912305205 1:108560114-108560136 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
912716936 1:111989769-111989791 AGCGGCGGAGGCTGCGGCAGCGG - Intergenic
913521360 1:119648152-119648174 TGCGGCGGCGGCGGCTGCAGCGG + Intergenic
914869048 1:151458605-151458627 TGCGGCGGAGGGGCGGGCGGCGG - Intronic
915200115 1:154221001-154221023 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
916052410 1:161045610-161045632 CGCGCCGCAGCCGCCGGCACCGG - Intronic
917755389 1:178093769-178093791 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
922335591 1:224616331-224616353 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
922464933 1:225840062-225840084 TGCCCCAGTGGAGCCGGCAGTGG - Intronic
922526676 1:226309348-226309370 TCGGCCGGAGGCGGCGGCGGAGG - Exonic
922952466 1:229570499-229570521 GGCGGCGGTGGCGACGGCAGTGG - Intergenic
924456435 1:244222586-244222608 TGCCCCAGAGGCGCTGGGAGTGG - Intergenic
924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG + Exonic
1063174507 10:3539485-3539507 AGCCCCAGAGGCGGCGGCAGTGG + Intergenic
1065023089 10:21516886-21516908 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1065588239 10:27240846-27240868 TGCGGCGGCGGCGGCGCCAGTGG - Intronic
1067060795 10:43077026-43077048 TGCGCCGGAGGAGCGGGTAGGGG - Exonic
1069019187 10:63466140-63466162 GGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1069024182 10:63521801-63521823 TGCGACGGCGGCGGCGGCTGTGG + Intronic
1070795603 10:79214654-79214676 TGCTCCAGAGGCGCCTGGAGGGG - Intronic
1072413872 10:95230974-95230996 CGAGCAGGAGGCGACGGCAGAGG - Intergenic
1072562231 10:96586896-96586918 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1072915522 10:99535450-99535472 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1073485770 10:103818258-103818280 TGCACCGGAGGAGGGGGCAGAGG - Intronic
1074419897 10:113299550-113299572 GGCGCTGCAGGCGCCGGGAGCGG + Intergenic
1074503109 10:114043927-114043949 GGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1075768920 10:124917177-124917199 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1076638919 10:131901034-131901056 GGCGGCGGCGGCGCCGGCGGTGG + Exonic
1076696309 10:132249049-132249071 TGCGACGGAGGCGGCGGCTCCGG + Intronic
1077081452 11:726244-726266 TGGGCCGGGGGCGGGGGCAGGGG + Intronic
1077877505 11:6320425-6320447 TGTGCCCGAGGCGCCGGCGGGGG - Exonic
1078659867 11:13278005-13278027 TGCCCCCGGGGCGGCGGCAGGGG - Intronic
1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG + Intergenic
1082928977 11:58579457-58579479 TGCGGCGGCGGCGGCCGCAGCGG - Exonic
1083232665 11:61333066-61333088 TGGGGCGGAGGCAGCGGCAGTGG - Exonic
1083317970 11:61828049-61828071 GGAGCCGGAGGGGCGGGCAGAGG + Exonic
1083728871 11:64642721-64642743 GGCGGTGGAGGCGGCGGCAGGGG + Intronic
1083989987 11:66240983-66241005 TGCACTGGAGCCGCCCGCAGGGG + Intronic
1085050256 11:73376673-73376695 TGCGCGGAAGGCGCCGGGACAGG - Intronic
1085318787 11:75562068-75562090 GGGCCGGGAGGCGCCGGCAGAGG + Intronic
1086001010 11:81986627-81986649 TGCGCCCGTGGCCCCGGCACCGG - Intergenic
1087672753 11:101127550-101127572 CGCCCCGGCGGCGGCGGCAGAGG + Exonic
1091088678 11:132748627-132748649 TGCGAGGGAGGGGCCTGCAGGGG + Intronic
1091445049 12:540219-540241 TGCGCCAGGGGCTCTGGCAGAGG - Intronic
1091558585 12:1594170-1594192 TGGGCCCGAGGCGGCGGCGGCGG - Intronic
1091866071 12:3838756-3838778 GGCGCCGGAGGGGCGGGGAGCGG - Intronic
1092335407 12:7628702-7628724 GGCGGCGGCGGCGGCGGCAGGGG - Intergenic
1092335415 12:7628723-7628745 GGCGGCGGCGGCGGCGGCAGGGG - Intergenic
1092335431 12:7628765-7628787 GGCGGCGGCGGCGGCGGCAGGGG - Intergenic
1093464990 12:19439895-19439917 GGCGGCGGAGGCGGCGGCGGAGG + Exonic
1094041027 12:26122282-26122304 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1094820387 12:34219628-34219650 CCCGCCGGAGGGGACGGCAGAGG + Intergenic
1096134487 12:49188387-49188409 TCTGCCGGAGCCCCCGGCAGCGG - Intronic
1096482457 12:51951713-51951735 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1096749948 12:53752155-53752177 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1096826214 12:54280079-54280101 TGCGCAGAAGGCGGCGGCGGTGG - Exonic
1096983745 12:55743415-55743437 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1097107675 12:56634966-56634988 GGCGGCGGCGGCGGCGGCAGAGG + Intronic
1097232830 12:57522755-57522777 AGCGACGGCGGCGGCGGCAGCGG + Exonic
1097264607 12:57738115-57738137 GGCACCGGCGGCGCCGGCCGCGG + Exonic
1098123825 12:67269644-67269666 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1099076833 12:78119864-78119886 TGCACCACAGGCGCTGGCAGAGG - Exonic
1101294129 12:103403264-103403286 TGCTCCGGAGGCTGAGGCAGGGG + Intronic
1102025881 12:109714197-109714219 AGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1103800354 12:123533733-123533755 GGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1104966145 12:132509576-132509598 GGGACCGCAGGCGCCGGCAGTGG - Intronic
1104983385 12:132583612-132583634 TGCGCCGAGGGCGGCGGCGGCGG - Exonic
1105900061 13:24746003-24746025 TGTGGCGGAGGCGCGGGCTGGGG - Intergenic
1107624844 13:42272051-42272073 TGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1108063189 13:46553150-46553172 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1108363828 13:49691314-49691336 TGCGCCTGGGCCGCGGGCAGGGG - Exonic
1108689270 13:52847303-52847325 TGCAGCGGCGGCGGCGGCAGCGG + Exonic
1108727783 13:53201093-53201115 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1110119756 13:71866522-71866544 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1111676810 13:91398651-91398673 GGCGGCGGAGGCGGCGGCGGCGG + Intergenic
1111676812 13:91398660-91398682 GGCGGCGGCGGCGGCGGCAGTGG + Exonic
1111951319 13:94711555-94711577 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1112402110 13:99086450-99086472 GGCGGCGGCGGCGCCGGGAGCGG - Intronic
1115399315 14:32939411-32939433 GGCGGCGGAGGCGGCGGCGGCGG - Intronic
1117424422 14:55580253-55580275 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
1117547840 14:56808037-56808059 TGCGCGGGGGGCGCGGGCAGTGG - Intronic
1117602571 14:57390638-57390660 TGCGAAGGAGGCGGCGGCGGTGG + Exonic
1117675610 14:58152154-58152176 TGCGGCGGCGGCGGCGGTAGCGG + Exonic
1118404983 14:65413411-65413433 AGCCCCGGGGGCGCGGGCAGAGG + Intronic
1121368087 14:93332858-93332880 GGCGGCGGAGGCGACGGCAGCGG - Exonic
1122081695 14:99271310-99271332 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
1122081696 14:99271316-99271338 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1122444987 14:101761683-101761705 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1122558293 14:102592963-102592985 GGCGGCGGAGGCGGCGGCGGCGG - Exonic
1124494473 15:30177996-30178018 TACACCGGAGGGGCAGGCAGGGG + Intergenic
1124652508 15:31484011-31484033 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1124749097 15:32360649-32360671 TACACCGGAGGGGCAGGCAGGGG - Intergenic
1125175624 15:36818427-36818449 TGGGCCGGAGCCGACGGCAGTGG - Intergenic
1125522932 15:40358240-40358262 GGCGGCGGTGGCGGCGGCAGCGG - Exonic
1125664164 15:41417145-41417167 AGCGGCGGCGGCGGCGGCAGTGG + Exonic
1125685025 15:41559004-41559026 GGCGACGGCGGCGACGGCAGTGG + Intronic
1126724990 15:51622784-51622806 TGCGCCGGTGCAGCAGGCAGTGG - Intronic
1128067854 15:64775595-64775617 GGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1128743302 15:70097449-70097471 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1129463063 15:75709666-75709688 TGCCCAGGAGGGGCGGGCAGGGG - Intronic
1129755993 15:78099421-78099443 TACTCAGGAGGCGCAGGCAGGGG - Intronic
1132641880 16:981787-981809 GGCGGCGGCGGCGGCGGCAGGGG + Exonic
1132709185 16:1258910-1258932 AGGGCCGGAGGGGCCGGGAGGGG - Exonic
1132743479 16:1427380-1427402 AGCACAGGAGGCCCCGGCAGTGG - Intergenic
1133156580 16:3880499-3880521 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1133271996 16:4614830-4614852 TGAGGCGGAGGCGCGGGCGGAGG - Exonic
1135712503 16:24729701-24729723 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1136511005 16:30738331-30738353 TGCGGCGGCGGCGGCAGCAGCGG + Exonic
1136641599 16:31569614-31569636 GGCGCAGGCGGCGGCGGCAGAGG + Intergenic
1137531577 16:49281772-49281794 AGCGGCGGCGGCGGCGGCAGCGG - Exonic
1137655256 16:50153549-50153571 TGCGCCTGAGGCGGCGGCGGCGG + Intronic
1138247623 16:55479277-55479299 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1138349547 16:56339174-56339196 TGCGCTGGGGGCGCATGCAGAGG + Intronic
1138360745 16:56425432-56425454 CGCGGCGGCGGCGGCGGCAGCGG - Exonic
1138619195 16:58198028-58198050 GGCGGCGGCGGCACCGGCAGCGG + Intergenic
1139606509 16:68022673-68022695 TGCGCCGCAGAAACCGGCAGTGG - Exonic
1140223133 16:73058241-73058263 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
1140223302 16:73058868-73058890 AGCGGCGGCGGCGGCGGCAGCGG + Intronic
1141972509 16:87492949-87492971 GGCGGAGGAGGCGCCGGCCGAGG + Intergenic
1142799709 17:2337548-2337570 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
1143240480 17:5439226-5439248 TGCACCGGAGTCTCCAGCAGAGG - Intronic
1143494978 17:7307667-7307689 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
1143527222 17:7479597-7479619 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
1143750498 17:9023402-9023424 TGCGGCGGCGGAGCCGGCGGCGG + Intronic
1144438304 17:15260805-15260827 AGCGACGGAGGCGCGCGCAGAGG + Intronic
1145925654 17:28644951-28644973 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1146912548 17:36658017-36658039 TGAGCCGGAGGCGCCCGCCCTGG + Intergenic
1147395665 17:40140663-40140685 AGCGCCGGAGGCGGCGGCAGCGG + Exonic
1147672393 17:42184178-42184200 CGCGACGGAGGCGGCGGCCGGGG + Exonic
1148060097 17:44830232-44830254 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
1148560168 17:48601641-48601663 TGCTCCAGAGGCGCCGAAAGAGG + Intronic
1149430525 17:56593385-56593407 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1149461542 17:56833698-56833720 GGCGGCGGCGGCGCCGGCATCGG + Exonic
1151558692 17:74859883-74859905 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
1151755332 17:76072442-76072464 GGCGGCGGCGGCGGCGGCAGTGG - Exonic
1151957391 17:77387201-77387223 TGGGCCGGAGCCTCCCGCAGAGG - Intronic
1152628130 17:81397586-81397608 GGCTCGGGAGGCGCCGGCCGGGG + Intronic
1152729546 17:81962708-81962730 TGCCCCCGAGCCGCCGGCCGGGG + Intergenic
1152798819 17:82321762-82321784 TGTGTCTGAGGCTCCGGCAGGGG + Exonic
1152834357 17:82519831-82519853 GGCGCCGGTGGCGCGGGCCGAGG - Exonic
1153219257 18:2847475-2847497 TCTGCCTGAGGCGCCGGCTGCGG - Intronic
1154294078 18:13134762-13134784 TGCGCAGGAGCCCACGGCAGGGG + Intergenic
1155007513 18:21741538-21741560 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1155392758 18:25352418-25352440 TGCGGCGGCGGCGACGGCGGCGG - Intergenic
1157614010 18:48976184-48976206 GGCGGCGGCGGCGGCGGCAGAGG + Intergenic
1157867059 18:51196780-51196802 TGCCCGGGAGGCGGCGGCCGCGG - Exonic
1158954157 18:62523593-62523615 GGCGGCGGCGGCGGCGGCAGAGG - Exonic
1159798103 18:72867780-72867802 GGCGGCGGCGGCGCCGGCGGCGG + Exonic
1160204653 18:76822738-76822760 GGCGCGGGGGGCGCCGGGAGCGG + Intronic
1160725377 19:615947-615969 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1160911982 19:1478804-1478826 TGTGCGGGGTGCGCCGGCAGAGG - Exonic
1161473333 19:4472272-4472294 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1161608723 19:5229346-5229368 AGCGCGGGAGGAGGCGGCAGGGG + Intronic
1161802665 19:6424616-6424638 GGAGCCGGAGGCGCCGGGGGAGG - Exonic
1161973307 19:7595883-7595905 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1162030903 19:7916867-7916889 CTCCCCGGAGGCGGCGGCAGCGG - Exonic
1162470911 19:10871622-10871644 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1162752685 19:12838513-12838535 AGCGGCGGAGGCGGCGGCGGCGG - Exonic
1162778652 19:12995613-12995635 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1162934148 19:13972831-13972853 AGCACCGGAGGCGGCGGCAGCGG - Exonic
1163138815 19:15332515-15332537 TGCGCTGGCGGCGGCGGCGGCGG - Intronic
1163435474 19:17292671-17292693 TCTTCTGGAGGCGCCGGCAGTGG + Exonic
1163586948 19:18169338-18169360 TGCGCCGGAGGCTGCGGCGGCGG + Exonic
1163606983 19:18280990-18281012 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1163607153 19:18281605-18281627 GGCGCAGGAGCCGCCGCCAGTGG - Exonic
1164639159 19:29812088-29812110 GGCGGCGGCGGCGACGGCAGTGG - Exonic
1164834533 19:31349239-31349261 AGCGGCGGCGGCGGCGGCAGTGG - Exonic
1165154340 19:33778112-33778134 TGCGCCCAAGCGGCCGGCAGGGG + Intergenic
1165204516 19:34172442-34172464 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1166337440 19:42116877-42116899 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
1166518525 19:43464274-43464296 TGGGCCGGAGGAGCCTGCAGTGG + Intronic
1166888058 19:45973452-45973474 TGCGGCGGCGGCGGCGGCGGGGG + Exonic
1167633487 19:50639808-50639830 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
1168076346 19:53982595-53982617 GGCGCCGGGGGCGGCGGCGGAGG + Exonic
1168102478 19:54148442-54148464 GGAGGCGGAGGCGGCGGCAGCGG + Exonic
1168272643 19:55258494-55258516 GGGGCCGGAGCCGCCGGCGGCGG - Exonic
1168296019 19:55377657-55377679 AGCACCGGAGACGCAGGCAGAGG - Exonic
1168718989 19:58544648-58544670 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
926131013 2:10303108-10303130 GGCGCCGGCGGCGGCTGCAGCGG - Intronic
926154888 2:10448264-10448286 GGCGCCGGAGCTGCTGGCAGAGG + Exonic
927713872 2:25341054-25341076 GGCGCCGGCGGGGCCGGGAGGGG - Intronic
929511441 2:42568645-42568667 AGCGACGGCGGCGGCGGCAGCGG + Intronic
932496596 2:72148658-72148680 GGCGGCGGCGGCGGCGGCAGCGG + Intergenic
933684715 2:85133709-85133731 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
933908138 2:86914498-86914520 TGCGGCGGCGGCGGCGGCGGCGG + Intronic
934011476 2:87824867-87824889 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
934296792 2:91748935-91748957 CGCGCTGGAGGCGGCGGCGGCGG - Intergenic
934783399 2:96987067-96987089 TGCGCGGGAGGCTGAGGCAGGGG + Intronic
935592896 2:104857083-104857105 GGCGGCGGCGGCGGCGGCAGGGG - Exonic
935746565 2:106194301-106194323 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
936221932 2:110610803-110610825 TTCGGCGGCGGCGGCGGCAGCGG - Intergenic
936278771 2:111120975-111120997 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
936322777 2:111480885-111480907 TGCTCCTGAGGAGCCGGCTGGGG + Intergenic
936954973 2:118014102-118014124 GGCGGCGGCGGCGGCGGCAGAGG - Exonic
937044989 2:118846549-118846571 TGCGGCGGCGGCGGCGGCCGCGG - Exonic
938273023 2:129992530-129992552 AGCGCCGGCGGCGGCGGCAGCGG + Intergenic
938443201 2:131353576-131353598 AGCGCCGGCGGCGGCGGCAGCGG - Intronic
939432661 2:142130787-142130809 GGCGGCGGCGGCGGCGGCAGGGG + Exonic
939900450 2:147844405-147844427 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
940517327 2:154698225-154698247 TGCGCCGGGGGTGCGGGGAGCGG + Intergenic
941951526 2:171160972-171160994 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
942453210 2:176121526-176121548 AGCGGCCGGGGCGCCGGCAGCGG - Intergenic
944715904 2:202376172-202376194 GGCGGCGGCGGCGCCGGCGGCGG - Intergenic
946149803 2:217756676-217756698 AGCTCCGGAGGCCCGGGCAGGGG - Intergenic
946325282 2:218981754-218981776 CGCGGCGGTGGCGGCGGCAGCGG + Exonic
946339253 2:219057733-219057755 TCAGCCGGAGGAGCCGGCCGAGG + Intronic
946966383 2:225042091-225042113 GGCGCCGGGGGAGCCCGCAGAGG + Intronic
947416358 2:229900750-229900772 TGCTCTGGAGGCTGCGGCAGGGG + Intronic
948746216 2:240095882-240095904 TGCGCCCGAGGCTCCTGCACCGG - Intergenic
949037383 2:241822103-241822125 TGCGCCGAGGGGGCCGGCTGAGG + Intergenic
1170150450 20:13221552-13221574 TGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1171724414 20:28602981-28603003 TCCGCCCGAGGCGCCGGTACTGG + Intergenic
1172015529 20:31870541-31870563 TGCGGCGGCGGCGGTGGCAGCGG - Exonic
1172331162 20:34077054-34077076 GGCGCCGGCGGCGGCGGCGGTGG + Exonic
1172951197 20:38724421-38724443 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1173864648 20:46306498-46306520 TGCCCCCGAGGCACTGGCAGTGG + Intronic
1173864909 20:46307601-46307623 CGCGCCGGTGGGGCCGGCAGGGG + Intronic
1174053918 20:47785447-47785469 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
1176062319 20:63177832-63177854 GGCGCGGGAGGCGCAGGGAGCGG + Intergenic
1176185321 20:63775300-63775322 GGCGACAGAGGGGCCGGCAGGGG + Intronic
1176207106 20:63895190-63895212 GGCGGCGGCGGCGGCGGCAGAGG - Exonic
1176220985 20:63969395-63969417 CGCGCAGGAGACGCCAGCAGCGG + Intronic
1176555714 21:8253276-8253298 TGCGCCCGCGCCGCCGTCAGGGG + Intergenic
1179561596 21:42219241-42219263 TGCCCCGGGGGCGGCGGCGGCGG - Exonic
1180014713 21:45074605-45074627 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
1180110263 21:45644030-45644052 GCCGCCGCAGGCGCCGGCGGCGG - Intronic
1180690466 22:17710468-17710490 TGCTCCGGAGGCTGAGGCAGGGG + Intronic
1180965264 22:19784809-19784831 TGCACCGGAGGCAGCGGCTGGGG + Exonic
1181574793 22:23787004-23787026 TGCGGCGGCGGCGGCGGCTGAGG + Exonic
1183931441 22:41238145-41238167 TGCGCCGGCTGCGGCTGCAGGGG - Exonic
1183990393 22:41593801-41593823 TGCGCAGGAGCCCACGGCAGAGG - Intergenic
1184037606 22:41926150-41926172 TGAGCTGGAGGCGGCGACAGCGG - Exonic
1184796883 22:46738008-46738030 CGCGCCGGGGGCGCCGGCTCCGG + Exonic
1184891059 22:47379357-47379379 GGCGGCGGAGGCGGCGGCGGCGG + Intergenic
1185335792 22:50270378-50270400 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
950388727 3:12679641-12679663 TGTGCTGGAAGAGCCGGCAGAGG - Intergenic
951029962 3:17870482-17870504 TGCTCCGGAGGCTGAGGCAGGGG - Intronic
951208322 3:19947262-19947284 AGCGCCGGCGGCGGCGGCGGCGG + Exonic
952942955 3:38457092-38457114 TGCGCCAGAGGCTGAGGCAGGGG + Intronic
953947780 3:47164027-47164049 GGCGGCGGCGGCGGCGGCAGGGG + Intergenic
954110220 3:48429393-48429415 CGCGCGGGAGGGGCGGGCAGCGG - Exonic
954210411 3:49093930-49093952 TGCAGCGGAGGCGGCGGCGGCGG - Exonic
954540653 3:51391331-51391353 GGCGGCGGAGGCGGCGGCCGAGG - Exonic
954540760 3:51391739-51391761 GGTGGCGGAGGCGGCGGCAGAGG - Exonic
955387608 3:58492055-58492077 GGCGGCGGCGGCGGCGGCAGAGG - Intergenic
955769243 3:62372540-62372562 GGCGGCGGAGGCGGCGGCGGCGG - Exonic
956659486 3:71583799-71583821 AGCGCCGGTGGCGGCGGCGGCGG + Intronic
956659489 3:71583808-71583830 GGCGGCGGCGGCGGCGGCAGAGG + Intronic
956678018 3:71753653-71753675 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
961377436 3:126476063-126476085 GGCGCCGGAGGCGGAGGCGGGGG + Intergenic
961827241 3:129605585-129605607 TGCGCGGGCGGCGCGGGCCGCGG - Exonic
962807902 3:138939765-138939787 GGCGACCGAGGCGCCGCCAGCGG - Intergenic
964198182 3:154088254-154088276 TGCGCAGGAGCCCACGGCAGTGG - Intergenic
964509735 3:157437691-157437713 CGCGCCGGGGGCTCCCGCAGAGG + Exonic
966883265 3:184361613-184361635 TGCGCCAGCGGCGCCCGCCGGGG - Exonic
968092668 3:195908707-195908729 GGACCCGGAGGCGCCGGCGGAGG - Intronic
968605569 4:1533564-1533586 TGCGGTGAAGGGGCCGGCAGGGG + Intergenic
968613518 4:1567488-1567510 TGGGCCGGAGGAGGGGGCAGAGG - Intergenic
968701297 4:2059393-2059415 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG + Intronic
969721278 4:8894160-8894182 TGGGCCGGGGGCGGCCGCAGAGG - Intergenic
970202900 4:13627547-13627569 GGCGCCGGAGGAGGCGGCTGCGG + Exonic
970332881 4:15003256-15003278 AGCGGCGGAGGCGGCGGCGGCGG - Exonic
970456239 4:16226628-16226650 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
971019048 4:22516041-22516063 GGCGGCGGCGGCGGCGGCAGAGG - Exonic
971279800 4:25233915-25233937 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
971539869 4:27802704-27802726 TGCTCCGGAGGCTGAGGCAGGGG + Intergenic
972535605 4:39997374-39997396 TGCGCAGGAGGCTGAGGCAGGGG - Intergenic
972793862 4:42397799-42397821 CCTGCGGGAGGCGCCGGCAGAGG - Intergenic
973279216 4:48341707-48341729 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
975166902 4:71187312-71187334 GGCGGCGGCGGCGGCGGCAGTGG + Exonic
976774903 4:88697682-88697704 AGCGGCGGAGGCAGCGGCAGAGG - Exonic
979349668 4:119628971-119628993 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
981127378 4:141122064-141122086 TGAGCAGGAGGCGCCTGGAGGGG - Intronic
981475205 4:145180488-145180510 GGCGCCGGAGGGGCAGGGAGCGG + Intergenic
981504223 4:145482164-145482186 TGGGCTGGGGGCGCGGGCAGCGG + Intronic
982157456 4:152535998-152536020 AGCGGCGGCGGCGGCGGCAGCGG + Exonic
984206366 4:176792441-176792463 CGAGCCGGAGGCGGCGGGAGCGG + Exonic
984206463 4:176792769-176792791 TGCGGCGGGGGCGCTGGCGGCGG + Intergenic
986330463 5:6713469-6713491 TGCGGCGGCGGCGGCGGCGGCGG - Intergenic
986330545 5:6713733-6713755 AGCGCCGGAGCCGCCCGCCGCGG + Intergenic
986330587 5:6713855-6713877 TGGGCCGGTGGCGGCGGCGGCGG - Intergenic
987087976 5:14487505-14487527 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
988547819 5:32174383-32174405 GGCGCCGGAAGCGGCGGCCGGGG + Intergenic
989523089 5:42423773-42423795 AGCGGCGGCGGCGGCGGCAGCGG + Intronic
990825434 5:59893363-59893385 GGCGGCGGGGGCGGCGGCAGGGG + Exonic
990955139 5:61332787-61332809 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
991342247 5:65624352-65624374 TGCGCCGGTGGCGTGCGCAGAGG - Exonic
994072825 5:95620843-95620865 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
995106237 5:108381012-108381034 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
995571695 5:113488347-113488369 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
996862817 5:128084239-128084261 TGCGGCGGCGGCGGCGGCGGCGG + Exonic
996862818 5:128084245-128084267 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
996862879 5:128084513-128084535 TCCGGCGGCGGCGGCGGCAGTGG + Exonic
997253584 5:132410528-132410550 AGAGCCCGAGGCGCCGCCAGCGG + Intergenic
999166183 5:149551305-149551327 TGGGCCGGAGCCGGCGGCAGTGG - Intronic
999696346 5:154190998-154191020 GGCGGCGGTGGCGCCGGCGGCGG + Exonic
1001506377 5:172283725-172283747 GGCGCCGGAGGAGGCTGCAGCGG - Exonic
1002000654 5:176194769-176194791 TGCGCGAGAGGAGCAGGCAGGGG + Intergenic
1002029304 5:176416300-176416322 TGCCCCGGAGGCGGCGGAGGAGG - Exonic
1002219948 5:177672224-177672246 GGCGGCGGGGGCGGCGGCAGCGG + Intergenic
1002253685 5:177944212-177944234 TGCGCGAGAGGAGCAGGCAGGGG - Intergenic
1002524238 5:179806664-179806686 GGCGGCGGCGGCGGCGGCAGGGG + Intronic
1002591072 5:180291977-180291999 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1002927104 6:1611046-1611068 TGCTCCGGCGGCGCGGGCGGGGG - Exonic
1004924055 6:20402378-20402400 CGCGCCCGGGGCGGCGGCAGCGG - Exonic
1007435850 6:41810040-41810062 TGCTCCGGAGGCTGAGGCAGGGG + Intronic
1007614473 6:43171992-43172014 TGGGCCCGAGGCGTCGGCAGCGG + Exonic
1007665296 6:43509941-43509963 TGCGGCGGAGGCTGCGGCGGGGG + Exonic
1007665358 6:43510154-43510176 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1007902223 6:45422765-45422787 TGCGGCGGCGGCGGCGGCTGCGG + Exonic
1010198467 6:73263052-73263074 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1010386331 6:75284723-75284745 TGCGGCGGCGGCGGCGGCAGCGG - Exonic
1011643033 6:89433104-89433126 GGCGTAGGAGCCGCCGGCAGGGG + Intergenic
1012211280 6:96521720-96521742 TGCGCCCGAGGCGCGGGGGGCGG - Intronic
1012475912 6:99614298-99614320 GGCACCGGGGGCGGCGGCAGCGG + Exonic
1013106142 6:107028172-107028194 TGCGCCGGCGCCGGCGGAAGGGG + Intergenic
1014137542 6:117907194-117907216 GGCGCCGGCGGCGGCGGCGGCGG - Intergenic
1015314812 6:131806494-131806516 TGCACGGGAGATGCCGGCAGCGG - Intergenic
1016010782 6:139135589-139135611 GGCGCCGGAGGCGCGGGGACTGG + Exonic
1016447775 6:144150571-144150593 GCCGCAGGAGGCGCCGGGAGCGG + Exonic
1017103156 6:150865925-150865947 GGCGGCGGAGGCGGCGGCGGTGG + Exonic
1018170524 6:161140019-161140041 TGCGCCGAAGCTGCCCGCAGGGG + Intronic
1019111921 6:169723994-169724016 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1019343418 7:518891-518913 TGCGCCGGAGGAGCCGGCGCAGG + Intronic
1019537986 7:1538776-1538798 TGACCAGCAGGCGCCGGCAGTGG - Intronic
1020020168 7:4861755-4861777 TTCGGCGGCGGCGCCGGCTGCGG + Exonic
1020204490 7:6104704-6104726 AGCGCCGGTCGGGCCGGCAGAGG - Intergenic
1020204545 7:6104906-6104928 TGACCCGGAGGCGGCGGCGGCGG + Exonic
1020727335 7:11832135-11832157 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1022090048 7:27102141-27102163 TGCGGCGGTGGCGGCGGCGGCGG + Exonic
1022101089 7:27169597-27169619 AGCGGCGGAGGCGGCGGCGGCGG - Intronic
1022207952 7:28180790-28180812 TGCGGCGGCGGCGTCGGGAGCGG + Intergenic
1022375281 7:29806603-29806625 GGAGCCGGAGGCGGCGGCGGCGG + Exonic
1024043861 7:45574559-45574581 CGCGGCGGAGGCGGCGGCGGAGG + Exonic
1028985553 7:97006116-97006138 TGCGGCGGCGGCGGCGGCGGCGG - Exonic
1029238795 7:99144026-99144048 GGCGGCGGAGGCGGCGGCGGAGG - Exonic
1029456215 7:100673839-100673861 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1029927008 7:104328796-104328818 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1030240522 7:107318135-107318157 TGCTCCGGAGGCTGAGGCAGGGG - Intronic
1031043448 7:116862570-116862592 CGCGGCGGCGGCGGCGGCAGCGG - Exonic
1032306231 7:130734190-130734212 CGCGCGGGCGGCGGCGGCAGCGG - Intergenic
1034441148 7:151086665-151086687 GGCGGCGGCGGCGGCGGCAGCGG - Intronic
1034441152 7:151086680-151086702 CGCGGCGGAGGCGGCGGCGGCGG - Intronic
1035169545 7:157009961-157009983 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1035266385 7:157692254-157692276 GGCCCCGGAGGGGCCGGGAGCGG - Intronic
1035519797 8:266816-266838 TGCGGAGGAGGCGCTGGGAGTGG + Intergenic
1035936380 8:3845947-3845969 TGCCCCTGAGGAGCCTGCAGTGG - Intronic
1036242457 8:7091913-7091935 TGCGCGGGAGAGGCCAGCAGAGG + Intergenic
1036258219 8:7221662-7221684 GGTGCCGGGGGCGCCGGTAGGGG - Intergenic
1036310267 8:7680258-7680280 GGTGCCGGGGGCGCCGGTAGGGG - Intergenic
1036359271 8:8065845-8065867 GGTGCCGGGGGCGCCGGTAGGGG + Intergenic
1036891687 8:12601107-12601129 GGTGCCGGGGGCGCCGGTAGGGG - Intergenic
1036899359 8:12659517-12659539 TGCGCGGGAGAGGCCAGCAGAGG - Intergenic
1037075383 8:14710258-14710280 TACGCCGGAGGCTGAGGCAGGGG + Intronic
1037390516 8:18387249-18387271 GGCGGCGGCGGCGCCGCCAGCGG - Intergenic
1037527372 8:19740125-19740147 TGCCCAGGAGGCACAGGCAGCGG - Intronic
1038296003 8:26291551-26291573 AGCGACGGCGGCGGCGGCAGCGG - Intronic
1038304031 8:26383280-26383302 CGCGCCGGTGGCGGCGGCCGGGG - Intronic
1038789788 8:30658144-30658166 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1038816875 8:30913041-30913063 TGCGCCGGGGGCGGAGCCAGAGG + Intergenic
1040951146 8:52939998-52940020 ACCGCCAGCGGCGCCGGCAGCGG - Exonic
1041689919 8:60678773-60678795 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1042246375 8:66712699-66712721 TCCGCGGGAGGAGCCGCCAGCGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1047100155 8:121667522-121667544 TGCGCAGGAGCCCCCGGCGGGGG + Intergenic
1047202988 8:122781975-122781997 GGGGCCGGCGGCGCCGGCTGGGG - Intronic
1048244142 8:132775398-132775420 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1048345594 8:133572261-133572283 GACGCCGGAGGCGGCGGCTGCGG + Intergenic
1049585631 8:143431181-143431203 AGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1049828615 8:144685818-144685840 TGGGCCGGCGGCGGCGGCGGAGG - Intergenic
1052362210 9:27573438-27573460 GGCGGCGGAGGCGCAGGCGGTGG - Intronic
1052888917 9:33677317-33677339 CGCGGGGGCGGCGCCGGCAGCGG - Intergenic
1053003318 9:34589694-34589716 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1053114610 9:35490122-35490144 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1053206551 9:36191082-36191104 ACCGCCAGGGGCGCCGGCAGGGG - Exonic
1053435141 9:38069223-38069245 GGCTCGGGAGGCGGCGGCAGTGG - Intergenic
1054762324 9:69014128-69014150 GGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1056773914 9:89497981-89498003 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
1057146924 9:92764809-92764831 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1057869778 9:98708895-98708917 CGCGGCGGCGGCGGCGGCAGCGG + Exonic
1057996129 9:99822750-99822772 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
1060897339 9:127225868-127225890 GGCGCCGGCGGCCCGGGCAGAGG - Intronic
1060979887 9:127785882-127785904 GGCGGCGGAGGCGGGGGCAGCGG + Intronic
1062209481 9:135356016-135356038 TGGGCCGGGGGCTCCGGCTGGGG - Intergenic
1062659138 9:137619189-137619211 TCGGCCTGAGGCGGCGGCAGCGG - Intronic
1185468932 X:371134-371156 TGGGCAGGAGGCGCAGGCAGTGG + Intronic
1186426068 X:9465124-9465146 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1186452927 X:9688139-9688161 TGCGGCGGCGGCGGCGGCTGCGG + Exonic
1187181439 X:16946876-16946898 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1187547318 X:20266732-20266754 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1187826184 X:23334783-23334805 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1188004401 X:25007242-25007264 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1188005533 X:25013655-25013677 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1189821478 X:44873365-44873387 GGCGGCGGCGGCGGCGGCAGGGG - Intronic
1190474405 X:50813140-50813162 GGCGGCGGCGGCGGCGGCAGTGG + Intronic
1190474414 X:50813170-50813192 GGCGGCGGCGGCGGCGGCAGCGG + Intronic
1190554394 X:51618679-51618701 TGCGGCGGAAGCGCCGGTGGCGG - Intergenic
1190881494 X:54495482-54495504 TGGGGCGGAGGCGCGGGCGGAGG + Exonic
1192925013 X:75747127-75747149 AGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1193743282 X:85244130-85244152 GGCGGCGGCGGCGGCGGCAGCGG + Exonic
1193819918 X:86148780-86148802 AGTGCCGGAGGCGGCGGCAGGGG + Exonic
1195668343 X:107449894-107449916 GGCGGCGGCGGCGGCGGCAGCGG - Intergenic
1196707340 X:118727684-118727706 TGCGCCGGCGGCGGGGGCGGGGG + Exonic
1197415299 X:126166129-126166151 GGCGGCGGCGGCGGCGGCAGCGG + Intergenic
1199445114 X:147912073-147912095 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1199500356 X:148500633-148500655 GGCGGCGGCGGCGGCGGCAGCGG - Exonic
1199772395 X:150983432-150983454 TGCGGCGGCGGCGGCGGCGGCGG - Intronic
1200048160 X:153413481-153413503 AGCCCTGGAGGGGCCGGCAGTGG + Intergenic
1200227810 X:154428791-154428813 GGCGGCGGCGGCGGCGGCAGCGG + Exonic