ID: 924546032

View in Genome Browser
Species Human (GRCh38)
Location 1:245028934-245028956
Sequence TGGTATGATTCCCATGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924546028_924546032 14 Left 924546028 1:245028897-245028919 CCTGTTTTTACTGAAATGGTTAC 0: 1
1: 0
2: 1
3: 24
4: 220
Right 924546032 1:245028934-245028956 TGGTATGATTCCCATGGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 97
924546027_924546032 15 Left 924546027 1:245028896-245028918 CCCTGTTTTTACTGAAATGGTTA 0: 1
1: 0
2: 1
3: 34
4: 299
Right 924546032 1:245028934-245028956 TGGTATGATTCCCATGGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924546032 Original CRISPR TGGTATGATTCCCATGGAGT GGG Intronic
909744976 1:79083647-79083669 TGATATGATACTCATGGAGTTGG - Intergenic
912170289 1:107091712-107091734 GGGCTTGATTCACATGGAGTTGG - Intergenic
912690156 1:111798858-111798880 TTGTATGATTCACTTGAAGTAGG + Intronic
912918789 1:113844751-113844773 TGGTTTGATTTCCAAGGATTTGG + Intronic
917252743 1:173079493-173079515 TGGTATGAGTGCCATGGTGTGGG - Intergenic
918342083 1:183576294-183576316 AGGAATGTTTCCCCTGGAGTTGG - Intronic
919567444 1:199206772-199206794 TGGTCATATTCACATGGAGTTGG + Intergenic
920286523 1:204883665-204883687 GGGTCAGATTCCCAGGGAGTGGG + Intronic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
924546032 1:245028934-245028956 TGGTATGATTCCCATGGAGTGGG + Intronic
1065433177 10:25680612-25680634 TCGGATGATTCCCATGAACTTGG + Intergenic
1066467045 10:35661342-35661364 TGGTATGATTCTCATGCACTTGG + Intergenic
1068608767 10:59035411-59035433 TGGAATTATGCCCATAGAGTTGG + Intergenic
1074049992 10:109872915-109872937 TGGTATGATTGGCATGGAAAGGG - Intronic
1076280591 10:129243079-129243101 TGGTTTGAGTCTCATGCAGTTGG - Intergenic
1077842853 11:5993949-5993971 TTGAATGGTTCGCATGGAGTTGG + Intergenic
1081034485 11:38125121-38125143 TGGAATTATTCCAATAGAGTGGG - Intergenic
1081523219 11:43903090-43903112 TGGTATAATTTCCATTGATTAGG + Intronic
1085529068 11:77181118-77181140 TGGTGTGGTCCCCATGGAGCAGG + Intronic
1085885763 11:80519865-80519887 TGGTGTGAATCCCAAGGAGAAGG - Intergenic
1086987008 11:93261627-93261649 TGGGATGATTCCCAAGAAGCAGG - Intergenic
1088086335 11:105985092-105985114 TGGAATGATTCTCATGAATTGGG - Intergenic
1091079910 11:132656927-132656949 TGGAATGTTTCCCATCGAATGGG - Intronic
1091644593 12:2264137-2264159 AGGTGTGACTCCCAGGGAGTAGG + Intronic
1091951867 12:4599583-4599605 TGGGAGGATGCCCATGGAGGTGG + Intronic
1093366239 12:18302701-18302723 TGGCATGATTCCCAAGGACCTGG + Intronic
1094814954 12:34173740-34173762 TGGAATGTTTTCCTTGGAGTAGG + Intergenic
1095590525 12:43897956-43897978 TTGTCTAATTCCCATGGCGTCGG + Intronic
1101035363 12:100700661-100700683 AGGAATAATTCCCATGGAATTGG + Intergenic
1101284284 12:103294276-103294298 TGGATTGATTCCCATAGAGGAGG + Intronic
1102329395 12:112015605-112015627 TTATCTGATTCCCATGGAGCAGG - Intronic
1105596667 13:21845546-21845568 TGGCATGAACCCCAGGGAGTCGG - Intergenic
1105991017 13:25621055-25621077 TGGTATCACTCCCATGCTGTTGG + Intronic
1112511207 13:100010976-100010998 TGGTTTGACATCCATGGAGTGGG + Intergenic
1114577942 14:23730300-23730322 TGGAAAGATTCCCTTGGAGAGGG - Intergenic
1116935192 14:50732406-50732428 TAGTATGATACCTATAGAGTAGG - Intronic
1119456934 14:74763897-74763919 TGGTTTGGTTCCAATGGAGCTGG + Exonic
1123573555 15:21641774-21641796 TGGTCTGCTTCCAATGGAGTTGG - Intergenic
1123610175 15:22084390-22084412 TGGTCTGCTTCCAATGGAGTTGG - Intergenic
1124831795 15:33155974-33155996 TGTTATCATTCCCAGGGTGTGGG - Intronic
1202982423 15_KI270727v1_random:376187-376209 TGGTCTGCTTCCAATGGAGTTGG - Intergenic
1138500702 16:57441976-57441998 TGGCATGATTGCCACTGAGTTGG - Intronic
1138767666 16:59623728-59623750 TGGGATGATTCCCAAGGTCTGGG + Intergenic
1153695915 18:7641562-7641584 TGGCATGAATCCCAAGAAGTGGG + Intronic
1157501492 18:48193921-48193943 TGGTGTGATTCAGAGGGAGTGGG + Intronic
1164455131 19:28400446-28400468 TGGTGTGAATCCCATGGTATAGG - Intergenic
927109762 2:19856110-19856132 TGGTGTCATTCCCAAGGAGAAGG + Intergenic
930343210 2:50144078-50144100 TGCTATGATTGCATTGGAGTGGG - Intronic
933517631 2:83326032-83326054 TGGTAAGCTTTCCATGGATTTGG + Intergenic
937084279 2:119160196-119160218 TGGTGTGATTCCCATGTTGGGGG - Intergenic
937558202 2:123186231-123186253 TGGTATGTTTTCCATAGTGTAGG - Intergenic
938570935 2:132561283-132561305 GGGTATGATTCACCTGGAGTGGG - Intronic
938782862 2:134601312-134601334 TGTTATTTTTCCCATGAAGTAGG - Intronic
943298664 2:186170158-186170180 TGGTATAATTCCAGTGGAGATGG - Intergenic
946430817 2:219626660-219626682 TGTTATGATTCCCATTTGGTCGG - Intergenic
1169146536 20:3256150-3256172 TGGCATGATGCTCAAGGAGTTGG + Exonic
1169869842 20:10238582-10238604 TAGTATGATCCTCATGAAGTTGG - Intronic
1171020488 20:21580262-21580284 TGGTAAGTTTCCCAAGGAGCTGG - Intergenic
1178387551 21:32165657-32165679 TTGTATGAATCCCATGGTTTTGG - Intergenic
1182975415 22:34619786-34619808 TGGTATGATTCAAGTGGAGATGG - Intergenic
1184830806 22:46985135-46985157 TGGTCTGATGCCCAGGAAGTTGG + Intronic
949849736 3:8410957-8410979 TGCTTTTGTTCCCATGGAGTTGG + Intergenic
950660783 3:14465690-14465712 TGGTATGATTCCTATGGTTAGGG - Intronic
953125626 3:40089050-40089072 TGGTGTCATTCCCAGGGAGGCGG + Intronic
953914093 3:46906833-46906855 TGGGATCATTCTCCTGGAGTTGG - Intergenic
955143680 3:56294735-56294757 TGGTGTGAATTCCAAGGAGTAGG + Intronic
956708293 3:72018388-72018410 TGATATGATTCCCATTGACACGG + Intergenic
960886066 3:122396223-122396245 TGAAAAGATACCCATGGAGTGGG + Intronic
963876658 3:150483563-150483585 CAGTATAATACCCATGGAGTTGG + Intergenic
965042269 3:163524605-163524627 TGATATTATTTCCATTGAGTAGG + Intergenic
967224498 3:187277763-187277785 TCATTTGATTCCCATGGAATAGG - Intronic
974129806 4:57740092-57740114 TGCTATGATTAGCATGAAGTGGG + Intergenic
975078012 4:70237485-70237507 TGGTTTGATGCCCATGGCTTTGG - Intergenic
979137504 4:117127985-117128007 TGGTAGCATACCCATGGTGTTGG + Intergenic
979594158 4:122514829-122514851 TGGTATGTTTCCCCTGGGGCAGG + Intergenic
982475993 4:155851381-155851403 TGGCATGATTCACTTGGATTGGG + Intronic
985112640 4:186561907-186561929 TGTTCTGCTTCCCAGGGAGTTGG + Intergenic
987166550 5:15204030-15204052 TACTATCATGCCCATGGAGTGGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991450450 5:66745351-66745373 ATGTATGGTGCCCATGGAGTGGG + Intronic
992368147 5:76114250-76114272 TGGCATTATTCCCATGGTGATGG - Intronic
993181821 5:84562960-84562982 TGGTGTAATTCAGATGGAGTAGG + Intergenic
995342871 5:111079271-111079293 TGGTATAATTCTCAGAGAGTTGG - Intergenic
999777129 5:154820414-154820436 TGGTGTCAGTCCCATGGAGGTGG + Exonic
1005472356 6:26173530-26173552 TGGAAGGATTCCCATAGAGGCGG - Intergenic
1005842177 6:29750903-29750925 TGCTATGAATCCCAGGCAGTGGG + Intergenic
1013794819 6:113875325-113875347 TTATATCATTTCCATGGAGTTGG + Intergenic
1017894014 6:158663661-158663683 TTGAATGATTCCCACGAAGTCGG - Intronic
1018582083 6:165316348-165316370 TGGCAAGATTCCCTTGGAGCAGG - Intergenic
1019600939 7:1883471-1883493 TGGGCTGATTCCCATGGAAATGG - Intronic
1021432527 7:20576814-20576836 TGATAAGATTCCCAAGGAATAGG - Intergenic
1024044231 7:45576122-45576144 TGGTATGACTCAAATGGAGTGGG + Intronic
1032515761 7:132504942-132504964 TGTTACGATTCCTTTGGAGTCGG - Intronic
1034102914 7:148466199-148466221 TAGTATGAGTACCATGGAATTGG - Intergenic
1038577401 8:28717036-28717058 TGGTGGGATTTCCATGAAGTTGG - Exonic
1040022220 8:42750921-42750943 TGGTATAATTACCATTGTGTTGG - Intergenic
1045934319 8:107661436-107661458 TGGTATTACTCCTCTGGAGTTGG + Intergenic
1048177678 8:132167821-132167843 TGGTATGCATCCCAAGGTGTTGG - Intronic
1050063408 9:1733928-1733950 TAGTATGACTCCAAAGGAGTTGG - Intergenic
1050096230 9:2069717-2069739 TGTTTTTATGCCCATGGAGTGGG + Intronic
1051367470 9:16331390-16331412 TGTCATGAATCCCCTGGAGTGGG + Intergenic
1057281756 9:93717836-93717858 TGGAATGCTTCCCAAGTAGTGGG - Intergenic
1059686851 9:116646026-116646048 TCTTTTGATTCCCATGAAGTAGG + Intronic
1192178732 X:68902378-68902400 TGGGCTGAGTCCCATGGTGTGGG + Intergenic
1195496672 X:105543358-105543380 TTAAATGATTCCTATGGAGTTGG + Intronic
1199552716 X:149076209-149076231 TGGTATTGTTGCCATGGATTTGG + Intergenic