ID: 924546243

View in Genome Browser
Species Human (GRCh38)
Location 1:245030510-245030532
Sequence TGTCCTTCCAGTACACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 323}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924546243_924546248 4 Left 924546243 1:245030510-245030532 CCTCTCAGTGTACTGGAAGGACA 0: 1
1: 0
2: 1
3: 20
4: 323
Right 924546248 1:245030537-245030559 TTGCCATTAGGGTAACACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 99
924546243_924546246 2 Left 924546243 1:245030510-245030532 CCTCTCAGTGTACTGGAAGGACA 0: 1
1: 0
2: 1
3: 20
4: 323
Right 924546246 1:245030535-245030557 TATTGCCATTAGGGTAACACAGG 0: 1
1: 0
2: 1
3: 21
4: 347
924546243_924546244 -8 Left 924546243 1:245030510-245030532 CCTCTCAGTGTACTGGAAGGACA 0: 1
1: 0
2: 1
3: 20
4: 323
Right 924546244 1:245030525-245030547 GAAGGACATTTATTGCCATTAGG 0: 1
1: 0
2: 0
3: 18
4: 141
924546243_924546247 3 Left 924546243 1:245030510-245030532 CCTCTCAGTGTACTGGAAGGACA 0: 1
1: 0
2: 1
3: 20
4: 323
Right 924546247 1:245030536-245030558 ATTGCCATTAGGGTAACACAGGG 0: 1
1: 0
2: 0
3: 5
4: 80
924546243_924546245 -7 Left 924546243 1:245030510-245030532 CCTCTCAGTGTACTGGAAGGACA 0: 1
1: 0
2: 1
3: 20
4: 323
Right 924546245 1:245030526-245030548 AAGGACATTTATTGCCATTAGGG 0: 1
1: 0
2: 1
3: 16
4: 192
924546243_924546250 28 Left 924546243 1:245030510-245030532 CCTCTCAGTGTACTGGAAGGACA 0: 1
1: 0
2: 1
3: 20
4: 323
Right 924546250 1:245030561-245030583 TCTCGTATTTCAAGTCACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924546243 Original CRISPR TGTCCTTCCAGTACACTGAG AGG (reversed) Intronic
900697969 1:4024072-4024094 TGTCCTTCCAGGAAACACAGAGG - Intergenic
903978706 1:27169594-27169616 TGTAATTCCAGTACTTTGAGAGG - Intergenic
904275516 1:29381626-29381648 TGTAATTCCAGTACATTGGGAGG - Intergenic
904739065 1:32658107-32658129 TGTAATTCCAGCACTCTGAGAGG - Intronic
906278473 1:44536185-44536207 ACTCCTCCCAGAACACTGAGTGG + Intronic
908221271 1:62009048-62009070 TTTACTTCCAGTAAATTGAGAGG - Intronic
908675900 1:66603570-66603592 TGTGTTTCCAGTACAGTGTGTGG - Intronic
909757487 1:79244650-79244672 TGTAATTCCAGCACACTGGGAGG - Intergenic
915265031 1:154710554-154710576 TGTCTTTCCAGTTCACTGAGGGG + Intronic
915331529 1:155115745-155115767 TGTAATCCCAGTACACTGGGAGG + Intergenic
916617788 1:166460473-166460495 TGTAATTCCAGTACTCTGGGAGG - Intergenic
917031703 1:170699976-170699998 TGTAATTCCAGTACTTTGAGAGG - Intronic
918220751 1:182434200-182434222 TGTAATCCCAGTACCCTGAGAGG - Intergenic
918806231 1:189049299-189049321 TATCCTTTCAGTACACTTTGAGG + Intergenic
918887129 1:190208749-190208771 TGTAATTCCAGCACATTGAGAGG - Intronic
920636492 1:207709577-207709599 TGTAATTCCAGTACATTGGGAGG + Intronic
921352010 1:214245455-214245477 TGTACTCCCAGTACATTGGGAGG - Intergenic
922908563 1:229196301-229196323 TGTAATTCCAGTGCTCTGAGAGG + Intergenic
923199254 1:231695433-231695455 TGTCCATCCAGTTATCTGAGAGG + Intronic
923497535 1:234538506-234538528 TCTCCTGCCAGTTCACTGGGAGG - Intergenic
924546243 1:245030510-245030532 TGTCCTTCCAGTACACTGAGAGG - Intronic
1064200632 10:13281987-13282009 TGTAATTCCAGTACTCTGGGAGG + Intronic
1064419111 10:15175168-15175190 TGTCATCCCAGCACACTGGGAGG + Intergenic
1064664730 10:17639115-17639137 TGCCCATCCAACACACTGAGAGG + Intergenic
1064924391 10:20554157-20554179 TTTGCTTCCAGTCCAGTGAGGGG + Intergenic
1065306920 10:24377945-24377967 TCTGTTTCCAGTACACTGTGGGG - Intronic
1066250320 10:33626688-33626710 TGTCATTCCAGTACTATGATTGG - Intergenic
1067477494 10:46576532-46576554 TGTCCATGCAGTACCCTGGGAGG - Intergenic
1067617246 10:47765252-47765274 TGTCCATGCAGTACCCTGGGAGG + Intergenic
1068898965 10:62242885-62242907 TGTAATCCCAGCACACTGAGAGG - Intronic
1069884241 10:71613511-71613533 TGTCCTCCCAGTCCACTGTATGG - Intronic
1070166912 10:73905830-73905852 TCCCCTTCCATTACACAGAGAGG - Intergenic
1070336412 10:75459182-75459204 TGTAATTCCAGTACTTTGAGAGG + Intronic
1071443238 10:85723013-85723035 TGTCCATCCTGGACACTGTGAGG + Exonic
1071784864 10:88887776-88887798 TGTGATCCCAGTACTCTGAGTGG - Intronic
1072115632 10:92367950-92367972 TGTCATTCCAGCACTCTGGGAGG - Intergenic
1072946605 10:99816220-99816242 TGTAATTCCAGCACACTGGGAGG - Intronic
1073824072 10:107300221-107300243 TGTCCTTCCATATCACTGGGAGG + Intergenic
1073833628 10:107415517-107415539 TGTCCTCCCAGTACACAGGTGGG + Intergenic
1073914867 10:108390600-108390622 TGTAATTCCAGCACACTGGGAGG + Intergenic
1075092750 10:119452673-119452695 CGTCCTTACAGTACACAGCGCGG - Exonic
1077429695 11:2510011-2510033 TGTCAATCCAGTACACTGGGAGG + Intronic
1083701622 11:64482977-64482999 TGTAATTCCAGTACACTGGGAGG + Intergenic
1083711155 11:64549555-64549577 TGTAATCCCAGTACACTGGGAGG + Intergenic
1084721764 11:70910549-70910571 TGTAATCCCAGCACACTGAGAGG + Intronic
1084886597 11:72212935-72212957 TGTCCTCCCAGCACTTTGAGAGG - Intergenic
1086204186 11:84238256-84238278 TGTCATTCCAATACTTTGAGAGG + Intronic
1087553694 11:99687304-99687326 TACAGTTCCAGTACACTGAGAGG - Intronic
1088477462 11:110258175-110258197 TGTTGTTCCAATACACTAAGAGG + Exonic
1088870056 11:113883142-113883164 TGTACTTCCAGCACCTTGAGGGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090610187 11:128464202-128464224 TGCCCTTCCAGTCCACTTACAGG + Intronic
1091442064 12:518654-518676 TGTAATTCTAGTACTCTGAGAGG - Intronic
1092234972 12:6801160-6801182 TGTAATTCCAGCACTCTGAGAGG - Intronic
1092496670 12:9002821-9002843 TGTACTTCCAGCACTTTGAGAGG - Intronic
1092807100 12:12234574-12234596 TGTAATTCCAGCACTCTGAGAGG + Intronic
1093028160 12:14263456-14263478 TGTCATCCCAGCACATTGAGAGG - Intergenic
1096274890 12:50198286-50198308 TGTACTTCCAGTACTTTGGGAGG + Intronic
1097000412 12:55871692-55871714 TGTAATTCCAGCACTCTGAGTGG - Intergenic
1097288290 12:57894171-57894193 TAGCCTTCCAGTAAAATGAGGGG - Intergenic
1098016875 12:66114591-66114613 TGTAATTCCAGTACTTTGAGAGG + Intergenic
1098239771 12:68455366-68455388 TTTCCTTTCAGGACACTGTGGGG - Intergenic
1100187497 12:92153571-92153593 TGTCATTCCAGCACTTTGAGAGG + Intergenic
1101620083 12:106377836-106377858 TGTAATCCCAGTGCACTGAGAGG + Intronic
1101643608 12:106607231-106607253 TATTTTTCCAGTAAACTGAGTGG - Intronic
1102120831 12:110439574-110439596 TGTAATCCCAGCACACTGAGAGG + Intronic
1102163702 12:110789367-110789389 TGTCATCCCAGTACTTTGAGAGG + Intergenic
1102816429 12:115869879-115869901 TGCCCTTCCAGATCACAGAGTGG + Intergenic
1104289981 12:127457602-127457624 TGTCATTCCAGCACTTTGAGAGG - Intergenic
1104448349 12:128850995-128851017 TGTAATTCCAGTACTCTGGGAGG + Intergenic
1104652277 12:130544212-130544234 TCCCCTTCCAGGACATTGAGAGG - Intronic
1105202454 13:18191866-18191888 TGTAATTCCAGCACTCTGAGAGG + Intergenic
1106155651 13:27153073-27153095 TGTAATCCCAGTACTCTGAGAGG + Intronic
1106182840 13:27383245-27383267 TGTCCTTACTGTGCACTGTGAGG + Intergenic
1107645756 13:42492912-42492934 TGTGATTCCAGCACATTGAGAGG + Intergenic
1108907587 13:55498005-55498027 TGTAATTCCAGTACTCTGGGAGG - Intergenic
1110305351 13:73980901-73980923 TGTAATTCCAGCACTCTGAGAGG + Intronic
1112265812 13:97922318-97922340 TGTAATTCCAGAACACTGGGAGG + Intergenic
1113729529 13:112630415-112630437 TGTCATTCCAGTACTTTGGGAGG + Intergenic
1113736845 13:112685264-112685286 TGTACTTCCAGCACTTTGAGAGG - Intergenic
1114064011 14:19044678-19044700 TGTCATTCCAGGACGTTGAGAGG - Intergenic
1114098248 14:19355318-19355340 TGTCATTCCAGGACGTTGAGAGG + Intergenic
1119615175 14:76094274-76094296 TGTCCTTCCAGCATGCTGAAAGG - Intergenic
1122656489 14:103264705-103264727 TGTAATTCCAGTACTTTGAGAGG - Intergenic
1123898321 15:24850569-24850591 TGTAATTCCAGTACATTGGGAGG - Intronic
1124270891 15:28279548-28279570 TGTAATCCCAGTACTCTGAGAGG + Intronic
1125750783 15:42026714-42026736 TGTAATTCCAGTACTGTGAGAGG + Intronic
1125958017 15:43804126-43804148 TGTCCTTACAGCAGACTCAGGGG - Intergenic
1127011192 15:54631086-54631108 TGTAATCCCAGCACACTGAGAGG + Exonic
1127445510 15:59059019-59059041 TGTAATTCCAGTACTTTGAGGGG + Intronic
1129175834 15:73839130-73839152 TGCCCTTCCAGGCCACTCAGTGG - Intergenic
1130566341 15:84999377-84999399 TGTAATCCCAGTACACTGGGAGG - Intronic
1130739834 15:86587324-86587346 TATCCTTGCAGCACTCTGAGAGG - Intronic
1133328553 16:4957370-4957392 TGTAATCCCAGCACACTGAGAGG - Intronic
1133631772 16:7628867-7628889 TGTCATTCCAGTACTTTGGGAGG - Intronic
1133708986 16:8382903-8382925 TGTAATCCCAGTACTCTGAGAGG - Intergenic
1133863145 16:9615886-9615908 TGTTCTTTCAGGAAACTGAGAGG - Intergenic
1134753070 16:16641839-16641861 TGTCCATCTGGTACACTGAAAGG - Intergenic
1134992987 16:18717237-18717259 TGTCCATCTGGTACACTGAAAGG + Intergenic
1135050145 16:19185873-19185895 TCGCCTTCCAGTGCACTAAGCGG + Intronic
1135169052 16:20166992-20167014 TGTCCTTCCTGTGCATTGAGGGG - Intergenic
1135395077 16:22125119-22125141 TGTATTTCCAGTACTTTGAGAGG + Intronic
1135768034 16:25194892-25194914 TGTACTGCTAATACACTGAGTGG + Intergenic
1136637383 16:31533371-31533393 TGTAATTACAGTACACTGGGAGG + Intergenic
1136669731 16:31845543-31845565 TGTAATTCCAGTACACTGGGAGG - Intergenic
1137666130 16:50250197-50250219 TGTAATTCCAGCACACTGGGAGG + Intronic
1138818995 16:60235722-60235744 TGTAATTCCAGCACATTGAGAGG + Intergenic
1138846576 16:60573963-60573985 TGTCATTCCAGCACATTGGGAGG - Intergenic
1139700939 16:68707628-68707650 TCTCCTTTCAGCCCACTGAGAGG - Intronic
1139829190 16:69782925-69782947 TGTAATTCCAGCACACTGGGAGG - Intronic
1140453672 16:75091791-75091813 TGTAATTCCAGTACTCTGGGAGG - Intronic
1141981594 16:87553642-87553664 TGTAATTCCAGCACACTGGGAGG - Intergenic
1142659587 17:1418677-1418699 TGTAATTCCAGCACACTGGGAGG + Intergenic
1145221471 17:21093040-21093062 TGTACTTCCAGCACTTTGAGAGG - Intergenic
1145773993 17:27513930-27513952 TGCCCTTCCAGCATATTGAGTGG + Intronic
1147291098 17:39443870-39443892 TGTAATTCTAGCACACTGAGAGG + Intronic
1147937646 17:44022356-44022378 TCTACTTCCAGTACACTGACTGG + Intronic
1148282933 17:46362925-46362947 TGTAATTCCAGCACACTGGGAGG + Intergenic
1148305150 17:46580850-46580872 TGTAATTCCAGCACACTGGGAGG + Intergenic
1148701356 17:49588930-49588952 AGCCCTTCCAGTGCACTGAGTGG + Intergenic
1149078789 17:52629718-52629740 TCTACTTTCAGAACACTGAGAGG + Intergenic
1149446420 17:56716835-56716857 TGTAATTCCAGTACTTTGAGAGG + Intergenic
1149918857 17:60637360-60637382 TGTAATCCCAGTACTCTGAGAGG - Intronic
1150594490 17:66592096-66592118 TGTAATTCCAGTACTTTGAGAGG + Intronic
1151754464 17:76065191-76065213 TGTAATCCCAGTACACTGGGAGG + Intronic
1152284850 17:79406428-79406450 TGTCCTGCCTGGACACGGAGTGG - Intronic
1152839520 17:82558074-82558096 TGTGCTTCCAGTACTTTGGGAGG + Intronic
1152882501 17:82827025-82827047 TGTCATCCCAGCACATTGAGAGG - Intronic
1153452327 18:5243674-5243696 TGTCATTCCAGCACTTTGAGAGG + Intergenic
1154340705 18:13499881-13499903 TGTCCTTCCAGTATGCTGCTTGG + Intronic
1155483365 18:26313922-26313944 TGTAATTCCAGTACTCTGGGAGG - Intronic
1155862852 18:30925909-30925931 TGTTCTGCCAGGACACTGAATGG - Intergenic
1157393610 18:47323959-47323981 TGTAATTCCAGTACTTTGAGAGG + Intergenic
1157610786 18:48953632-48953654 TGTACTCCCAGTACTTTGAGAGG - Intergenic
1157660099 18:49433951-49433973 TGTAATTCCAGCACCCTGAGAGG + Intronic
1159029879 18:63219972-63219994 TTTCCTTCCAGAAGACAGAGTGG + Intronic
1159179336 18:64881253-64881275 TGTAATCCCAGTACTCTGAGGGG + Intergenic
1160618778 18:80154971-80154993 TGTACTTCCAGTAGACTGTCAGG - Intronic
1160997945 19:1893121-1893143 TGTACTTCCAGCACTTTGAGAGG + Intergenic
1161557033 19:4949570-4949592 TGTCGTTCCAGTACTTTGGGAGG + Intronic
1162356113 19:10186044-10186066 TGTCCTTCCAGTTTTCTCAGCGG - Intronic
1162671102 19:12258571-12258593 TGTAATTCCAGCACACTGGGAGG + Intronic
1162873008 19:13600030-13600052 TCTCCCTCCAGCACAGTGAGGGG + Intronic
1163401253 19:17094289-17094311 TGTAATTCCAGTACTTTGAGAGG - Intronic
1163961765 19:20703200-20703222 TGTAATTCCAGCACACTGGGAGG + Intronic
1165051864 19:33146979-33147001 TGTAATTCCAGTACTCTGGGAGG + Intronic
1165053989 19:33162013-33162035 TGTCCTTTAATTACACTAAGCGG + Intronic
1165312446 19:35037011-35037033 TGTCATTCCAGCACTCTGGGAGG - Intronic
1165531136 19:36402737-36402759 TGTAATTCCAGTACTCTGGGAGG + Intronic
1166120575 19:40684020-40684042 TGTAATTCCAGCACACTGGGAGG - Intronic
1166527733 19:43523531-43523553 TGTAATTCCAGTACGTTGAGAGG - Intronic
1166936350 19:46335524-46335546 TGTAATTCCAGCACATTGAGAGG - Intronic
1167013390 19:46823670-46823692 TGTAATCCCAGTACACTGGGAGG - Intergenic
1167028479 19:46940112-46940134 TGTAGTTCCAGTACTTTGAGAGG + Intronic
1167128934 19:47571989-47572011 TGTCCTCCTGGAACACTGAGTGG + Intergenic
1167920043 19:52775750-52775772 TGTAATTCCAGTACTTTGAGAGG + Intronic
926176881 2:10601513-10601535 CCTCTTTCCAGTGCACTGAGAGG + Intronic
927690261 2:25203236-25203258 TGTACTTCCAGCACTTTGAGAGG - Intergenic
927936862 2:27080928-27080950 TCTCCCCCCAGTCCACTGAGGGG - Exonic
928073073 2:28237191-28237213 TGTCCTTTCAGTGCACTTGGAGG + Exonic
929475696 2:42245350-42245372 TGTACTTCCAGAACTTTGAGGGG - Intronic
931375875 2:61707652-61707674 TGTCATCCCAGTACTTTGAGAGG - Intergenic
932076111 2:68664406-68664428 TGTGCTTCCATCACAGTGAGGGG + Intergenic
932659336 2:73639049-73639071 TGTAATTCCAGTACTCTGGGAGG - Intergenic
933554057 2:83809907-83809929 TGTACTTCCAGTACTGTGGGAGG + Intergenic
935531716 2:104240670-104240692 TGTAATTCCAGTGCACTGGGAGG + Intergenic
936025460 2:109028011-109028033 TGTAATTCCAGCACACTGGGGGG + Intergenic
937292678 2:120790985-120791007 TGTCTTCCCAGTACCCTGGGAGG + Intronic
938013830 2:127850828-127850850 TGTAATTCCAGCACTCTGAGAGG + Intronic
938481272 2:131663662-131663684 TGTCATTCCAGGACGTTGAGAGG - Intergenic
939335363 2:140820234-140820256 TGTAATTCCAGTACTTTGAGAGG - Intronic
939809662 2:146815090-146815112 TGTCCATCCTGCACACTGACTGG - Intergenic
939898060 2:147816483-147816505 TGTAATTCCAGTACTCTGAGAGG - Intergenic
940007113 2:149018030-149018052 TGTACTCCCAGCACTCTGAGAGG + Intronic
940273933 2:151919568-151919590 TGTACTTGCAGGACCCTGAGGGG - Intronic
940347626 2:152643971-152643993 TGTAATTCCAGTACTTTGAGAGG + Intronic
940848260 2:158663753-158663775 TGACCTTCCCTTACACTGTGTGG - Intronic
941368890 2:164639844-164639866 TGTAATTCCAGCACATTGAGAGG - Intergenic
941765178 2:169288973-169288995 TTTCATTACAGTACACTGATGGG - Intronic
942993720 2:182235396-182235418 TGTAATTCCAGTACTTTGAGAGG - Intronic
943735409 2:191348546-191348568 GGTCCTCCCTGTACACTGAGTGG + Intronic
944574961 2:201082519-201082541 TGTAATTCCAGCACTCTGAGAGG - Intronic
944899852 2:204203097-204203119 TGTAATTCCAGTACTCTGGGAGG - Intergenic
947299879 2:228677331-228677353 TGACCTTGCAGTACACTGGGGGG + Intergenic
947667257 2:231914170-231914192 CTTCCTTCCTGGACACTGAGGGG - Intergenic
948519380 2:238525820-238525842 TGTCATTCCAGTGCTCTGGGAGG + Intergenic
1169841607 20:9944075-9944097 TGTAATTCCAGTACTTTGAGAGG + Intergenic
1170090074 20:12580914-12580936 TGTAATTCCAGCACATTGAGAGG - Intergenic
1172045485 20:32077123-32077145 TGTCCTTTCAGGGCACTCAGGGG + Intronic
1172861134 20:38053087-38053109 TGTCCTGCCTGTAAACAGAGTGG + Intronic
1173572372 20:44085749-44085771 TGTCATCCCAGCACTCTGAGTGG - Intergenic
1174329383 20:49805855-49805877 TGTCATTCCAGCACTCTGGGAGG + Intergenic
1175321996 20:58094722-58094744 TGTCTTGCCAGGACTCTGAGGGG + Intergenic
1175823306 20:61923533-61923555 TGTCCTTCCAGTCCACGGCAGGG + Exonic
1178066923 21:28914811-28914833 TGTAATTCCAGCACATTGAGAGG - Intergenic
1178186796 21:30231431-30231453 TGTCATTCCAGCACTTTGAGAGG + Intergenic
1178335362 21:31737662-31737684 TGTAATCCCAGTACATTGAGAGG - Intergenic
1180482503 22:15767312-15767334 TGTCATTCCAGGACGTTGAGAGG - Intergenic
1180602852 22:17033811-17033833 TGTAATTCCAGCACTCTGAGAGG + Intergenic
1181575075 22:23788660-23788682 TGTCATTCCAGCACTTTGAGAGG - Intronic
1181776025 22:25160752-25160774 TGTCCTTGGAGCCCACTGAGGGG + Intronic
1183451521 22:37898557-37898579 AGCCCTCTCAGTACACTGAGAGG - Intergenic
1184134598 22:42539692-42539714 TGTAATCCCAGTACTCTGAGGGG + Intergenic
1184201013 22:42969680-42969702 TGTAATTCCAGCACTCTGAGAGG + Intronic
949851797 3:8427673-8427695 TGTAATTCCAGTACTTTGAGAGG - Intergenic
949995203 3:9611175-9611197 TGTCCTTTCTTTACACTGGGAGG - Intergenic
950409583 3:12826666-12826688 TGTCCTCCCAGCACTTTGAGAGG - Intronic
950612737 3:14136729-14136751 TGTCCTTCCAGAACATTAGGAGG + Intronic
953118399 3:40015363-40015385 TGTCTTTGCAGTACTCTGACTGG - Intronic
953139751 3:40216723-40216745 TATCTTTCTATTACACTGAGAGG - Intronic
953308960 3:41858406-41858428 TGTAATTCCAGTACTCTGGGAGG - Intronic
953510822 3:43537175-43537197 TGTCCTTCCTACACACTCAGTGG + Intronic
955026770 3:55175126-55175148 TGTAATCCCAGCACACTGAGAGG + Intergenic
955785505 3:62533828-62533850 TGTAATTCCATTAAACTGAGAGG + Intronic
956561074 3:70575321-70575343 TATCCCTCCAGGCCACTGAGAGG + Intergenic
956797973 3:72733097-72733119 TGTGCTCCCAGTACACTCAACGG + Intergenic
959339979 3:105117107-105117129 TGTAATTCCAGTACTCTGGGAGG + Intergenic
960415187 3:117376523-117376545 TGTAATCCCAGCACACTGAGAGG + Intergenic
961010298 3:123430922-123430944 TTTCCTTCCTGTCCACTGTGTGG - Intronic
964194109 3:154042041-154042063 TGTGATTCCAGCACATTGAGAGG - Intergenic
965247928 3:166299515-166299537 TGTAATTCCAGTACTTTGAGAGG + Intergenic
965641317 3:170831457-170831479 CGTCCTTCCAGCACACAGAAGGG - Intronic
966590427 3:181676215-181676237 TGTAATTCCAGTACTTTGAGAGG - Intergenic
966988758 3:185207029-185207051 TGTAATTCCAGTACTCTGGGAGG + Intronic
968279928 3:197468719-197468741 TATCATCCCAGTAGACTGAGAGG - Intergenic
968458375 4:710515-710537 TGTCTCTCCAGTGCCCTGAGAGG - Intronic
968885810 4:3331572-3331594 TGCTTTTCCAGTACAATGAGAGG + Intronic
970298348 4:14655638-14655660 TGCCCTCACAGTACACTGTGTGG - Intergenic
970620928 4:17817410-17817432 AGTCCCACCAGTTCACTGAGAGG - Exonic
970704914 4:18789074-18789096 TGTAATTCCAGCACACTGGGAGG - Intergenic
970711088 4:18863375-18863397 TGTCTTCCCAGCATACTGAGAGG - Intergenic
971331694 4:25686722-25686744 TGTAATTCCAGTACATTGAGAGG - Intergenic
971838247 4:31797552-31797574 TGTAATTCCAGCACTCTGAGAGG - Intergenic
972478758 4:39478245-39478267 TGTAATTCCAGCACTCTGAGAGG + Intergenic
975852249 4:78584430-78584452 TGTAATTCCAGTACTTTGAGAGG - Intronic
979230887 4:118347971-118347993 TGTAATTCCAGTACTCTGGGAGG + Intronic
979888106 4:126057735-126057757 TATCCTTCCAGTTCTTTGAGAGG - Intergenic
979940602 4:126758360-126758382 TGTCCATCCAGAATTCTGAGTGG + Intergenic
980747942 4:137044882-137044904 TGTAATTCCAGCACACTGAGAGG - Intergenic
981144817 4:141312006-141312028 TTTCCTTGTACTACACTGAGGGG - Intergenic
981818216 4:148855561-148855583 TGTAATTCCAGAACACTGGGAGG - Intergenic
983021148 4:162676644-162676666 TGTAATTCCAGTACTCTGGGAGG + Intergenic
984282898 4:177693633-177693655 TGTCATCCCAGTACTTTGAGTGG + Intergenic
986847554 5:11773555-11773577 TGTAATCCCAGTACACTGGGAGG + Intronic
988592193 5:32558449-32558471 TGTCCTCCCAGAACACGAAGAGG + Intronic
989389447 5:40885338-40885360 TGTAATTCCAGCACACTGGGAGG + Intergenic
989747650 5:44849501-44849523 TGTACTTCCAGCACTCTGGGAGG + Intergenic
990652484 5:57917744-57917766 TGTAATTCCAGTACTTTGAGAGG - Intergenic
991162282 5:63517745-63517767 TGTAATTCCAGCACTCTGAGAGG - Intergenic
992110283 5:73486446-73486468 TGTATTTCCAGAACACTGGGAGG - Intergenic
992713991 5:79491173-79491195 TGTAATTCCAGCACACTGGGAGG + Intronic
992830932 5:80592905-80592927 TGTAATTCCAGCACTCTGAGAGG - Intergenic
993907813 5:93642774-93642796 TGTAATTCCAGTACTTTGAGAGG - Intronic
995224148 5:109685361-109685383 TGTACTTCCAGCACTTTGAGAGG - Intergenic
995497210 5:112758857-112758879 TGTAATTCCAGTACTTTGAGAGG - Intronic
996436896 5:123443747-123443769 TGTAATCCCAGTACACTGAGGGG - Intergenic
996791370 5:127297221-127297243 TGTAATTCCAGTACTTTGAGAGG - Intronic
996833951 5:127770467-127770489 TGTCCTGGCAGTGCAGTGAGTGG - Intergenic
997167163 5:131673777-131673799 TGTAATTCCAGCACTCTGAGAGG + Intronic
997281664 5:132652256-132652278 TGTGATTCCAGCACACTGGGAGG + Intergenic
998344704 5:141451623-141451645 TGTAATTCCAGCACTCTGAGAGG + Intronic
998892264 5:146758720-146758742 TGTCCTTCCATTCCCCAGAGTGG - Intronic
999751824 5:154633173-154633195 TGTAATTCCAGCACTCTGAGAGG - Intergenic
1000828478 5:166074936-166074958 TGTAATTCCAGCACACTGGGAGG - Intergenic
1001949377 5:175805658-175805680 TTTCCTTCCAGCACAGTCAGAGG + Intronic
1002277210 5:178111708-178111730 TGTACTCCCAGCACACTGAGAGG + Intergenic
1003202783 6:3977560-3977582 TGACCTTTCAGAACACTGAGAGG - Intergenic
1004724259 6:18295978-18296000 TGTAATTCCAGTACTTTGAGGGG - Intergenic
1004960882 6:20786751-20786773 TGTAATTCCAGCACACTGGGAGG - Intronic
1008689487 6:53961821-53961843 TTTCCTTCCAGTTAAATGAGGGG - Intronic
1009491481 6:64297719-64297741 TGTAATTCCAGCACTCTGAGAGG + Intronic
1010432677 6:75796722-75796744 TGTAATTCCAGCACTCTGAGAGG - Intronic
1010745942 6:79561766-79561788 TGCCCTTCCAGTAATCTGAGTGG + Intergenic
1013485143 6:110589700-110589722 TGTAATTCCAGTACTCTGGGAGG - Intergenic
1015893867 6:137998022-137998044 TGTAATCCCAGTACTCTGAGAGG + Intergenic
1019680908 7:2348694-2348716 TGTAATTCCAGCACTCTGAGAGG + Intronic
1020012465 7:4814034-4814056 TGTCCTCCCAGTGCTTTGAGAGG - Intronic
1020024631 7:4890339-4890361 TGTCATTCCAGCACTTTGAGAGG - Intergenic
1022796187 7:33733209-33733231 TGTAATCCCAGTACTCTGAGAGG - Intergenic
1022983692 7:35628655-35628677 TGTCCTCCCATTACACTTTGGGG - Intergenic
1025186223 7:56861662-56861684 TGTCATTCCAGCACATTGAAAGG + Intergenic
1025685699 7:63715247-63715269 TGTCATTCCAGCACATTGAAAGG - Intergenic
1026116349 7:67498998-67499020 TGTAATTCCAGTACTTTGAGAGG + Intergenic
1026187315 7:68092021-68092043 TGTCATTCCAGCACATTGGGAGG + Intergenic
1026952857 7:74359223-74359245 TGTAATCCCAGTACACTGGGAGG - Intronic
1027389113 7:77688061-77688083 TGTAATTCCAGTACTCTGGGAGG + Intergenic
1027910064 7:84238971-84238993 TGTCATCCCAGTACTTTGAGAGG - Intronic
1028070005 7:86440370-86440392 TTTCCTTCCTGGACACTGAGAGG + Intergenic
1029018288 7:97337612-97337634 TGTAATTCCAGCACACTGGGAGG + Intergenic
1029203914 7:98857177-98857199 TGTCATTCCAGTGCTTTGAGAGG - Intronic
1029395286 7:100303983-100304005 TGTAATTCCAGCACTCTGAGAGG + Intergenic
1029402527 7:100354870-100354892 TGTAATCCCAGCACACTGAGAGG + Intronic
1029545734 7:101209646-101209668 TGTAATCCCAGTACATTGAGAGG - Intronic
1029751860 7:102547353-102547375 TGTAGTTCCAGTACTTTGAGAGG + Intronic
1029769812 7:102646444-102646466 TGTAGTTCCAGTACTTTGAGAGG + Intronic
1029879815 7:103796610-103796632 TGTAATCCCAGTACTCTGAGAGG + Intronic
1030284639 7:107813477-107813499 TGTAATTCCAGTACTTTGAGAGG - Intergenic
1030339228 7:108358149-108358171 TGTATTTCCAGTACTGTGAGAGG + Intronic
1030524675 7:110638796-110638818 TGGCCTTCCTGTATAGTGAGAGG - Intergenic
1031909510 7:127500266-127500288 TGTAATTCCAGAACTCTGAGAGG - Intergenic
1031956710 7:127949948-127949970 TTTCTTTCAAGTACAGTGAGAGG - Intronic
1032823889 7:135550703-135550725 TGTAATTCCAGCACTCTGAGAGG - Intergenic
1033122197 7:138676090-138676112 TGTCATCCCAGCACACTGGGAGG - Intronic
1033582267 7:142748958-142748980 TGACCTTCCTGCACACTGACTGG + Intergenic
1035152038 7:156882774-156882796 TGTAATCCCAGTACTCTGAGAGG + Intronic
1035754842 8:2023388-2023410 TGTCCATCCTGTTCACTGAAGGG + Intergenic
1037190236 8:16115719-16115741 TGTCATTCCAGTACTTTGGGAGG + Intronic
1038164482 8:25071984-25072006 TGTACTTCCAGCACTTTGAGAGG - Intergenic
1039096201 8:33888931-33888953 TGTAATTCCAGCACACTGGGAGG - Intergenic
1039704580 8:39993751-39993773 TGTAATCCCAGCACACTGAGAGG + Intronic
1040051288 8:43016915-43016937 TGTAATTCCAGTACTTTGAGTGG + Intronic
1042012994 8:64270470-64270492 TGTCATTCCAATACATAGAGAGG + Intergenic
1042182942 8:66110205-66110227 TGTCATTCCAGTACTTTGGGAGG - Intergenic
1042390090 8:68224271-68224293 TGTAATTCCAGTACTTTGAGGGG - Intronic
1044749430 8:95401964-95401986 AGCCCTTCCATTGCACTGAGTGG - Intergenic
1046855961 8:119032383-119032405 TGTCCTCTCAGTACACTGTGTGG - Intronic
1047733658 8:127747238-127747260 TGTAATTCCAGTACTTTGAGAGG + Intergenic
1048297802 8:133227565-133227587 TGTCCTTCCAGTGTCCTGATGGG + Exonic
1051736148 9:20201085-20201107 TCTCCTTCAAGTACACAGAGTGG + Intergenic
1053453415 9:38212244-38212266 TGTCCTTCCAGTGCACGAAAAGG - Intergenic
1057460539 9:95256764-95256786 TCTCCTTACAGCACACTGATGGG - Intronic
1059206904 9:112475923-112475945 TGTCATTCCAGCACTTTGAGAGG - Intronic
1059718159 9:116932747-116932769 TGTACTTCCAGCACTTTGAGAGG + Intronic
1059733488 9:117079097-117079119 TGTAATCCCAGTACATTGAGAGG + Intronic
1059851881 9:118350867-118350889 TGTAATTCCAGTACATTGGGAGG - Intergenic
1060076576 9:120595820-120595842 TGTAATACCAGCACACTGAGAGG - Intergenic
1061124460 9:128665511-128665533 TGTAATTCCAGTACATTAAGAGG + Intergenic
1062644797 9:137542210-137542232 TGTAATTCCAGTGCTCTGAGAGG + Intronic
1186090614 X:6044009-6044031 TGTAATTCCAGCACTCTGAGAGG + Intronic
1187978768 X:24732209-24732231 TGTAATTCCAGCACTCTGAGAGG - Intronic
1188100344 X:26074615-26074637 TGTAATTCCAGCACATTGAGAGG - Intergenic
1188225606 X:27593053-27593075 TGTCATTCCAGCACTCTGGGAGG - Intronic
1188336204 X:28936520-28936542 TATCATTACAGTACACTCAGGGG - Intronic
1189532250 X:41897738-41897760 TGAGCTTCCTGTACACTAAGAGG + Intronic
1189775858 X:44469806-44469828 TGTCATCCCAGTACATTGGGAGG + Intergenic
1192611193 X:72569025-72569047 TGTTCTTCCACTGCACTGTGCGG + Intronic
1193377466 X:80778740-80778762 TGTCATTCCAGCACTTTGAGAGG + Intronic
1194447924 X:94009618-94009640 TGTAATTCCAGTAGTCTGAGAGG - Intergenic
1195631202 X:107057123-107057145 TGTAATCCCAGTACTCTGAGAGG - Intergenic
1195743041 X:108085644-108085666 TGTCTTGGCAGTAGACTGAGTGG + Intronic
1197028408 X:121783212-121783234 TGTCCTTCAAGTTTACTTAGAGG + Intergenic
1197997984 X:132400608-132400630 TTTCCTTCCAAAACCCTGAGAGG - Intronic
1200010790 X:153119332-153119354 TGTAATTCCAGCACACTGAGAGG - Intergenic
1200028810 X:153280590-153280612 TGTAATTCCAGCACACTGAGAGG + Intergenic
1201718820 Y:17075346-17075368 TGTAATTCCAGCACATTGAGAGG - Intergenic